Incidental Mutation 'R6274:Ikzf1'
ID507537
Institutional Source Beutler Lab
Gene Symbol Ikzf1
Ensembl Gene ENSMUSG00000018654
Gene NameIKAROS family zinc finger 1
SynonymsLyF-1, 5832432G11Rik, Zfpn1a1, Ikaros
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location11685003-11772926 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 11768961 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 310 (Q310*)
Ref Sequence ENSEMBL: ENSMUSP00000075992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018798] [ENSMUST00000065433] [ENSMUST00000076700]
Predicted Effect probably null
Transcript: ENSMUST00000018798
AA Change: Q223*
SMART Domains Protein: ENSMUSP00000018798
Gene: ENSMUSG00000018654
AA Change: Q223*

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
low complexity region 282 293 N/A INTRINSIC
ZnF_C2H2 371 393 7.49e0 SMART
ZnF_C2H2 399 423 5.34e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065433
AA Change: Q330*
SMART Domains Protein: ENSMUSP00000067372
Gene: ENSMUSG00000018654
AA Change: Q330*

DomainStartEndE-ValueType
ZnF_C2H2 137 159 1.43e-1 SMART
ZnF_C2H2 165 187 8.02e-5 SMART
ZnF_C2H2 193 215 2.57e-3 SMART
ZnF_C2H2 221 244 8.22e-2 SMART
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 5.34e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076700
AA Change: Q310*
SMART Domains Protein: ENSMUSP00000075992
Gene: ENSMUSG00000018654
AA Change: Q310*

DomainStartEndE-ValueType
ZnF_C2H2 117 139 1.43e-1 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 2.57e-3 SMART
ZnF_C2H2 201 224 8.22e-2 SMART
low complexity region 369 380 N/A INTRINSIC
ZnF_C2H2 458 480 7.49e0 SMART
ZnF_C2H2 486 510 5.34e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Ikzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Ikzf1 APN 11 11768923 missense probably damaging 1.00
IGL01367:Ikzf1 APN 11 11748358 missense probably benign 0.04
IGL01823:Ikzf1 APN 11 11769091 missense possibly damaging 0.64
IGL02342:Ikzf1 APN 11 11700216 utr 5 prime probably benign
IGL02452:Ikzf1 APN 11 11748545 missense probably damaging 1.00
IGL03209:Ikzf1 APN 11 11700226 missense probably benign
IGL03236:Ikzf1 APN 11 11707848 missense probably damaging 1.00
Herrscher UTSW 11 11768961 nonsense probably null
Star_lord UTSW 11 11769448 missense probably damaging 1.00
waxwing UTSW 11 11748464 nonsense probably null
R0133:Ikzf1 UTSW 11 11741015 splice site probably null
R0417:Ikzf1 UTSW 11 11769352 missense probably benign 0.19
R0633:Ikzf1 UTSW 11 11769223 missense probably damaging 1.00
R0734:Ikzf1 UTSW 11 11758195 missense probably damaging 1.00
R1693:Ikzf1 UTSW 11 11707838 missense probably damaging 1.00
R2114:Ikzf1 UTSW 11 11769473 missense probably damaging 1.00
R2927:Ikzf1 UTSW 11 11769324 missense probably damaging 1.00
R4250:Ikzf1 UTSW 11 11754166 missense probably damaging 1.00
R5156:Ikzf1 UTSW 11 11769448 missense probably damaging 1.00
R5912:Ikzf1 UTSW 11 11748464 nonsense probably null
R7614:Ikzf1 UTSW 11 11769019 missense probably damaging 1.00
R7727:Ikzf1 UTSW 11 11748339 missense probably damaging 1.00
R7759:Ikzf1 UTSW 11 11769256 missense probably damaging 0.98
Z1176:Ikzf1 UTSW 11 11758194 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCACCTTATCCCTCCTGAG -3'
(R):5'- ACACAGACTTGGCCTTGGAC -3'

Sequencing Primer
(F):5'- TGAGCCCTGGCAGATGTGTC -3'
(R):5'- CTTGGACAGCAGCAGCAAGTTATC -3'
Posted On2018-03-15