Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Wnk4'

507540

Institutional Source

Beutler Lab

Gene Symbol

Wnk4

Ensembl Gene

ENSMUSG00000035112

Gene Name

WNK lysine deficient protein kinase 4

Synonyms

2010002J11Rik, Prkwnk4

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101260567-101277409 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101265431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 42 (R42W)

Ref Sequence

ENSEMBL: ENSMUSP00000132123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103108] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000170056]

AlphaFold

Q80UE6

Predicted Effect

probably damaging
Transcript: ENSMUST00000103108
AA Change: R479W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: R479W

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
low complexity region	95	105	N/A	INTRINSIC
low complexity region	126	155	N/A	INTRINSIC
Pfam:Pkinase_Tyr	171	427	4.7e-42	PFAM
Pfam:Pkinase	171	429	9e-55	PFAM
Pfam:OSR1_C	450	486	3e-18	PFAM
low complexity region	503	513	N/A	INTRINSIC
low complexity region	516	530	N/A	INTRINSIC
low complexity region	544	560	N/A	INTRINSIC
low complexity region	627	638	N/A	INTRINSIC
low complexity region	660	678	N/A	INTRINSIC
low complexity region	757	778	N/A	INTRINSIC
low complexity region	793	808	N/A	INTRINSIC
low complexity region	841	877	N/A	INTRINSIC
low complexity region	882	915	N/A	INTRINSIC
low complexity region	921	951	N/A	INTRINSIC
low complexity region	1014	1033	N/A	INTRINSIC
low complexity region	1093	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139487

SMART Domains

Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
low complexity region	95	105	N/A	INTRINSIC
low complexity region	126	155	N/A	INTRINSIC
Pfam:Pkinase_Tyr	171	242	4e-8	PFAM
Pfam:Pkinase	171	252	1.9e-10	PFAM
low complexity region	269	283	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147741

SMART Domains

Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
low complexity region	95	105	N/A	INTRINSIC
low complexity region	126	155	N/A	INTRINSIC
Pfam:Pkinase	171	394	9.3e-50	PFAM
Pfam:Pkinase_Tyr	171	399	3.7e-38	PFAM
low complexity region	401	413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156205

Predicted Effect

probably damaging
Transcript: ENSMUST00000170056
AA Change: R42W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112
AA Change: R42W

Domain	Start	End	E-Value	Type
Pfam:OSR1_C	13	49	8.6e-20	PFAM
low complexity region	66	76	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC

Meta Mutation Damage Score

0.2548

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Wnk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wnk4	APN	11	101268748	missense	possibly damaging	0.47
IGL00535:Wnk4	APN	11	101264349	missense	probably damaging	1.00
IGL01401:Wnk4	APN	11	101276683	splice site	probably benign
IGL01931:Wnk4	APN	11	101268484	missense	possibly damaging	0.94
IGL01977:Wnk4	APN	11	101265414	missense	probably damaging	1.00
IGL02165:Wnk4	APN	11	101275291	unclassified	probably benign
IGL02197:Wnk4	APN	11	101263957	missense	probably damaging	1.00
IGL02457:Wnk4	APN	11	101269563	splice site	probably benign
IGL02963:Wnk4	APN	11	101276213	unclassified	probably benign
ashamed	UTSW	11	101265431	missense	probably damaging	1.00
blushing	UTSW	11	101265377	missense	probably damaging	0.96
Caught_dead	UTSW	11	101264330	missense	probably damaging	1.00
lowered	UTSW	11	101268492	critical splice donor site	probably null
mortification	UTSW	11	101263894	makesense	probably null
shame	UTSW	11	101262856	missense	probably damaging	1.00
R0066:Wnk4	UTSW	11	101265435	missense	probably damaging	1.00
R0317:Wnk4	UTSW	11	101268804	missense	probably benign	0.01
R0628:Wnk4	UTSW	11	101275023	missense	probably benign	0.10
R0630:Wnk4	UTSW	11	101265386	missense	probably damaging	1.00
R0710:Wnk4	UTSW	11	101274106	missense	probably benign	0.22
R1290:Wnk4	UTSW	11	101276340	unclassified	probably benign
R1482:Wnk4	UTSW	11	101269636	missense	probably damaging	0.99
R1775:Wnk4	UTSW	11	101276340	unclassified	probably benign
R2005:Wnk4	UTSW	11	101263890	missense	probably damaging	1.00
R2229:Wnk4	UTSW	11	101275641	unclassified	probably benign
R2258:Wnk4	UTSW	11	101275035	missense	probably damaging	0.98
R2323:Wnk4	UTSW	11	101268481	missense	probably damaging	0.99
R3081:Wnk4	UTSW	11	101276891	splice site	probably benign
R3763:Wnk4	UTSW	11	101269288	missense	probably benign	0.00
R4196:Wnk4	UTSW	11	101269631	missense	probably damaging	1.00
R4447:Wnk4	UTSW	11	101268451	missense	possibly damaging	0.65
R4614:Wnk4	UTSW	11	101274111	missense	probably benign	0.00
R4751:Wnk4	UTSW	11	101276362	unclassified	probably benign
R4948:Wnk4	UTSW	11	101268281	missense	probably damaging	1.00
R5067:Wnk4	UTSW	11	101262856	missense	probably damaging	1.00
R5073:Wnk4	UTSW	11	101261188	missense	probably damaging	1.00
R5107:Wnk4	UTSW	11	101275538	unclassified	probably benign
R5181:Wnk4	UTSW	11	101265377	missense	probably damaging	0.96
R5205:Wnk4	UTSW	11	101265138	missense	possibly damaging	0.89
R5252:Wnk4	UTSW	11	101268748	missense	possibly damaging	0.47
R5273:Wnk4	UTSW	11	101263869	missense	probably damaging	1.00
R5293:Wnk4	UTSW	11	101275197	unclassified	probably benign
R5609:Wnk4	UTSW	11	101275636	unclassified	probably benign
R5915:Wnk4	UTSW	11	101263894	makesense	probably null
R5931:Wnk4	UTSW	11	101261221	missense	probably damaging	0.99
R6126:Wnk4	UTSW	11	101276348	unclassified	probably benign
R6164:Wnk4	UTSW	11	101275068	missense	possibly damaging	0.56
R6191:Wnk4	UTSW	11	101264330	missense	probably damaging	1.00
R6267:Wnk4	UTSW	11	101273998	missense	probably damaging	1.00
R6296:Wnk4	UTSW	11	101273998	missense	probably damaging	1.00
R7132:Wnk4	UTSW	11	101261200	missense	probably benign	0.22
R7251:Wnk4	UTSW	11	101265153	missense	possibly damaging	0.70
R7352:Wnk4	UTSW	11	101264418	missense	probably damaging	1.00
R7404:Wnk4	UTSW	11	101268492	critical splice donor site	probably null
R7624:Wnk4	UTSW	11	101264354	nonsense	probably null
R7634:Wnk4	UTSW	11	101262895	missense	probably damaging	1.00
R7780:Wnk4	UTSW	11	101269577	missense	probably damaging	0.96
R8006:Wnk4	UTSW	11	101268356	missense	probably benign	0.00
R8046:Wnk4	UTSW	11	101274092	missense	probably benign	0.20
R8143:Wnk4	UTSW	11	101262799	missense	probably damaging	1.00
R8458:Wnk4	UTSW	11	101275321	nonsense	probably null
R8735:Wnk4	UTSW	11	101276266	missense	unknown
R9025:Wnk4	UTSW	11	101262815	nonsense	probably null
R9206:Wnk4	UTSW	11	101274056	missense	probably damaging	1.00
R9295:Wnk4	UTSW	11	101269252	missense	probably damaging	0.98
R9610:Wnk4	UTSW	11	101268424	nonsense	probably null
R9611:Wnk4	UTSW	11	101268424	nonsense	probably null
R9674:Wnk4	UTSW	11	101276048	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGTTCACCATCCAGGATCTCC -3'
(R):5'- AAAAGAACCCTGGTGTGCG -3'

Sequencing Primer
(F):5'- AGGATCTCCTGGCCCATG -3'
(R):5'- TGTGCGCAGACGGATTAG -3'

Posted On

2018-03-15