Incidental Mutation 'R6274:Serpinb1a'
ID 507541
Institutional Source Beutler Lab
Gene Symbol Serpinb1a
Ensembl Gene ENSMUSG00000044734
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 1a
Synonyms MNEI, LEI, 1190005M04Rik, EIA, ovalbumin, M/NEI, ELANH2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 32842092-32851185 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32842866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 364 (H364Q)
Ref Sequence ENSEMBL: ENSMUSP00000075690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076352] [ENSMUST00000091668]
AlphaFold Q9D154
Predicted Effect probably damaging
Transcript: ENSMUST00000076352
AA Change: H364Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075690
Gene: ENSMUSG00000044734
AA Change: H364Q

DomainStartEndE-ValueType
SERPIN 13 379 1.19e-190 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091668
SMART Domains Protein: ENSMUSP00000089257
Gene: ENSMUSG00000044734

DomainStartEndE-ValueType
SERPIN 13 348 1.5e-151 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223016
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteinase inhibitors. Members of this family maintain homeostasis by neutralizing overexpressed proteinase activity through their function as suicide substrates. This protein inhibits the neutrophil-derived proteinases neutrophil elastase, cathepsin G, and proteinase-3 and thus protects tissues from damage at inflammatory sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice fail to clear P. aeruginosa lung infection and show increased mortality associated with late-onset failed bacterial clearance, partly due to elevated neutrophil necrosis, release of neutrophil protease activity, higher cytokine production and proteolysis of surfactant protein-D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Serpinb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Serpinb1a APN 13 32845415 missense probably benign 0.03
IGL02470:Serpinb1a APN 13 32850393 missense probably damaging 0.98
IGL03215:Serpinb1a APN 13 32850369 missense probably damaging 0.99
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0121:Serpinb1a UTSW 13 32848771 splice site probably benign
R0335:Serpinb1a UTSW 13 32848656 missense probably damaging 1.00
R0387:Serpinb1a UTSW 13 32848738 missense probably benign 0.03
R0751:Serpinb1a UTSW 13 32843216 missense probably benign
R1184:Serpinb1a UTSW 13 32843216 missense probably benign
R2096:Serpinb1a UTSW 13 32847454 missense probably damaging 1.00
R2165:Serpinb1a UTSW 13 32850414 splice site probably benign
R3432:Serpinb1a UTSW 13 32842859 missense possibly damaging 0.47
R5247:Serpinb1a UTSW 13 32850406 start codon destroyed probably damaging 1.00
R5669:Serpinb1a UTSW 13 32845316 missense probably damaging 1.00
R7133:Serpinb1a UTSW 13 32850325 missense possibly damaging 0.69
R7358:Serpinb1a UTSW 13 32842998 missense probably damaging 1.00
R7944:Serpinb1a UTSW 13 32850256 missense probably benign 0.34
R7994:Serpinb1a UTSW 13 32843050 missense probably damaging 1.00
R8213:Serpinb1a UTSW 13 32842999 missense probably damaging 1.00
R8272:Serpinb1a UTSW 13 32845737 missense probably damaging 1.00
R9023:Serpinb1a UTSW 13 32845780 missense probably damaging 0.99
R9287:Serpinb1a UTSW 13 32842963 missense probably damaging 1.00
R9423:Serpinb1a UTSW 13 32842927 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACCCATGCCAAAAGTCATGG -3'
(R):5'- TCTCTGGCATGTCAGGATCC -3'

Sequencing Primer
(F):5'- CCATGCCAAAAGTCATGGATATAAAG -3'
(R):5'- GCATGTCAGGATCCAGAGATCTTTTC -3'
Posted On 2018-03-15