Incidental Mutation 'R6274:Il3ra'
ID507543
Institutional Source Beutler Lab
Gene Symbol Il3ra
Ensembl Gene ENSMUSG00000068758
Gene Nameinterleukin 3 receptor, alpha chain
SynonymsIL-3 receptor alpha chain, CD123, SUT-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location14346275-14356011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14350180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 112 (V112I)
Ref Sequence ENSEMBL: ENSMUSP00000153086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]
Predicted Effect unknown
Transcript: ENSMUST00000090591
AA Change: V205I
SMART Domains Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: V205I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL6Ra-bind 119 233 6.1e-33 PFAM
transmembrane domain 333 355 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223589
Predicted Effect unknown
Transcript: ENSMUST00000224163
AA Change: V205I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224415
Predicted Effect probably benign
Transcript: ENSMUST00000224877
AA Change: V112I

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225560
Predicted Effect probably benign
Transcript: ENSMUST00000225775
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Il3ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02454:Il3ra APN 14 14351113 missense probably benign 0.36
IGL02547:Il3ra APN 14 14351970 missense probably benign 0.01
IGL02550:Il3ra APN 14 14348055 missense probably benign 0.03
IGL02632:Il3ra APN 14 14350807 critical splice donor site probably null
IGL02737:Il3ra APN 14 14350760 missense probably benign 0.02
R0165:Il3ra UTSW 14 14350967 missense probably benign 0.01
R0597:Il3ra UTSW 14 14351166 critical splice donor site probably null
R1109:Il3ra UTSW 14 14349317 missense probably damaging 1.00
R2211:Il3ra UTSW 14 14355029 missense probably benign 0.03
R2409:Il3ra UTSW 14 14349377 splice site probably null
R4258:Il3ra UTSW 14 14347961 missense probably damaging 1.00
R4896:Il3ra UTSW 14 14355381 missense probably benign 0.07
R4994:Il3ra UTSW 14 14351080 missense probably benign 0.19
R5004:Il3ra UTSW 14 14355381 missense probably benign 0.07
R5935:Il3ra UTSW 14 14350799 missense probably damaging 0.99
R6350:Il3ra UTSW 14 14348903 missense probably benign 0.07
R6403:Il3ra UTSW 14 14347137 missense probably damaging 0.98
R6845:Il3ra UTSW 14 14346517 splice site probably null
R7417:Il3ra UTSW 14 14349345 missense probably benign 0.08
R7432:Il3ra UTSW 14 14350691 missense possibly damaging 0.64
R7450:Il3ra UTSW 14 14351090 missense probably benign 0.25
R7917:Il3ra UTSW 14 14350773 missense possibly damaging 0.66
R8048:Il3ra UTSW 14 14348903 missense probably benign 0.07
Z1088:Il3ra UTSW 14 14351129 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGGGTGTGACTTCACTTCC -3'
(R):5'- CATAGTAGGCCTGACTGAGC -3'

Sequencing Primer
(F):5'- GGTGTGACTTCACTTCCTGTGTC -3'
(R):5'- CCTGACTGAGCCCCGGG -3'
Posted On2018-03-15