Incidental Mutation 'R6274:Myh7'
ID 507544
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Name myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms beta-MHC, MyHC-I, MYH-beta/slow, betaMHC, Myhcb, Myhc-b, B-MHC
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.912) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 55208141-55232083 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55216943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1138 (D1138G)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085949] [ENSMUST00000102803] [ENSMUST00000168485]
AlphaFold Q91Z83
Predicted Effect probably benign
Transcript: ENSMUST00000085949
Predicted Effect probably damaging
Transcript: ENSMUST00000102803
AA Change: D1138G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: D1138G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably damaging
Transcript: ENSMUST00000168485
AA Change: D1138G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: D1138G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Meta Mutation Damage Score 0.9080 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 55,224,845 (GRCm39) missense probably damaging 1.00
IGL01025:Myh7 APN 14 55,216,994 (GRCm39) missense probably damaging 1.00
IGL01092:Myh7 APN 14 55,209,089 (GRCm39) missense possibly damaging 0.91
IGL01384:Myh7 APN 14 55,208,916 (GRCm39) missense probably damaging 1.00
IGL01457:Myh7 APN 14 55,226,336 (GRCm39) missense possibly damaging 0.66
IGL01671:Myh7 APN 14 55,210,381 (GRCm39) missense probably damaging 1.00
IGL01923:Myh7 APN 14 55,222,916 (GRCm39) critical splice donor site probably null
IGL02183:Myh7 APN 14 55,212,188 (GRCm39) missense probably benign
IGL02379:Myh7 APN 14 55,216,925 (GRCm39) missense probably damaging 1.00
IGL02884:Myh7 APN 14 55,230,276 (GRCm39) missense probably benign 0.26
IGL02898:Myh7 APN 14 55,221,197 (GRCm39) missense probably damaging 1.00
IGL03027:Myh7 APN 14 55,221,007 (GRCm39) missense probably damaging 1.00
IGL03061:Myh7 APN 14 55,228,661 (GRCm39) unclassified probably benign
IGL03145:Myh7 APN 14 55,220,802 (GRCm39) missense probably damaging 1.00
IGL03250:Myh7 APN 14 55,229,704 (GRCm39) missense probably damaging 1.00
IGL03394:Myh7 APN 14 55,212,818 (GRCm39) missense probably damaging 1.00
BB008:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
BB018:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
R0019:Myh7 UTSW 14 55,221,191 (GRCm39) missense possibly damaging 0.91
R0030:Myh7 UTSW 14 55,229,427 (GRCm39) missense probably benign 0.00
R0183:Myh7 UTSW 14 55,216,333 (GRCm39) missense probably benign 0.02
R0230:Myh7 UTSW 14 55,211,390 (GRCm39) missense probably benign 0.03
R0295:Myh7 UTSW 14 55,222,278 (GRCm39) splice site probably benign
R0423:Myh7 UTSW 14 55,216,646 (GRCm39) missense probably benign 0.06
R0537:Myh7 UTSW 14 55,228,256 (GRCm39) missense possibly damaging 0.81
R0541:Myh7 UTSW 14 55,212,158 (GRCm39) missense probably benign
R0581:Myh7 UTSW 14 55,222,953 (GRCm39) missense probably benign 0.02
R0786:Myh7 UTSW 14 55,230,330 (GRCm39) start codon destroyed probably null
R0866:Myh7 UTSW 14 55,210,596 (GRCm39) missense probably benign
R1068:Myh7 UTSW 14 55,224,776 (GRCm39) missense possibly damaging 0.93
R1075:Myh7 UTSW 14 55,224,860 (GRCm39) missense probably benign
R1124:Myh7 UTSW 14 55,211,327 (GRCm39) missense possibly damaging 0.78
R1140:Myh7 UTSW 14 55,210,339 (GRCm39) missense probably damaging 1.00
R1260:Myh7 UTSW 14 55,225,908 (GRCm39) missense probably benign 0.00
R1653:Myh7 UTSW 14 55,228,246 (GRCm39) missense probably benign 0.00
R1677:Myh7 UTSW 14 55,224,973 (GRCm39) missense probably benign 0.17
R1760:Myh7 UTSW 14 55,210,170 (GRCm39) missense probably damaging 1.00
R1838:Myh7 UTSW 14 55,210,637 (GRCm39) missense possibly damaging 0.91
R1839:Myh7 UTSW 14 55,210,637 (GRCm39) missense possibly damaging 0.91
R2483:Myh7 UTSW 14 55,210,838 (GRCm39) missense probably damaging 0.99
R2566:Myh7 UTSW 14 55,220,699 (GRCm39) missense probably damaging 1.00
R3623:Myh7 UTSW 14 55,210,838 (GRCm39) missense probably damaging 0.99
R3916:Myh7 UTSW 14 55,211,503 (GRCm39) missense probably damaging 0.97
R4236:Myh7 UTSW 14 55,228,575 (GRCm39) missense probably benign 0.34
R4471:Myh7 UTSW 14 55,229,311 (GRCm39) nonsense probably null
R4700:Myh7 UTSW 14 55,225,778 (GRCm39) missense possibly damaging 0.85
R4805:Myh7 UTSW 14 55,222,590 (GRCm39) missense probably benign 0.27
R4880:Myh7 UTSW 14 55,216,045 (GRCm39) missense probably benign 0.18
R4975:Myh7 UTSW 14 55,209,128 (GRCm39) missense probably damaging 1.00
R4982:Myh7 UTSW 14 55,210,224 (GRCm39) missense probably damaging 0.98
R5004:Myh7 UTSW 14 55,209,140 (GRCm39) missense probably damaging 0.99
R5107:Myh7 UTSW 14 55,223,881 (GRCm39) intron probably benign
R5124:Myh7 UTSW 14 55,223,199 (GRCm39) nonsense probably null
R5256:Myh7 UTSW 14 55,216,965 (GRCm39) missense probably damaging 1.00
R5335:Myh7 UTSW 14 55,224,020 (GRCm39) intron probably benign
R5581:Myh7 UTSW 14 55,216,411 (GRCm39) missense probably benign 0.00
R5861:Myh7 UTSW 14 55,226,347 (GRCm39) missense possibly damaging 0.89
R5957:Myh7 UTSW 14 55,226,535 (GRCm39) missense probably damaging 1.00
R6027:Myh7 UTSW 14 55,208,259 (GRCm39) missense probably benign 0.01
R6184:Myh7 UTSW 14 55,226,315 (GRCm39) missense probably damaging 1.00
R6232:Myh7 UTSW 14 55,226,753 (GRCm39) missense probably benign 0.00
R6268:Myh7 UTSW 14 55,226,741 (GRCm39) missense probably benign 0.00
R6345:Myh7 UTSW 14 55,221,149 (GRCm39) missense probably damaging 1.00
R6383:Myh7 UTSW 14 55,226,351 (GRCm39) missense probably benign 0.00
R6641:Myh7 UTSW 14 55,219,737 (GRCm39) missense probably benign 0.37
R6755:Myh7 UTSW 14 55,229,770 (GRCm39) missense possibly damaging 0.71
R6952:Myh7 UTSW 14 55,229,197 (GRCm39) missense probably damaging 1.00
R7025:Myh7 UTSW 14 55,212,101 (GRCm39) nonsense probably null
R7201:Myh7 UTSW 14 55,228,402 (GRCm39) missense possibly damaging 0.58
R7257:Myh7 UTSW 14 55,209,947 (GRCm39) splice site probably null
R7296:Myh7 UTSW 14 55,227,482 (GRCm39) missense probably benign 0.05
R7709:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7710:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7711:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7712:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7817:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7858:Myh7 UTSW 14 55,227,500 (GRCm39) missense probably benign 0.09
R7869:Myh7 UTSW 14 55,226,530 (GRCm39) missense probably damaging 0.99
R7870:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7887:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
R7931:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
R7936:Myh7 UTSW 14 55,216,920 (GRCm39) missense possibly damaging 0.93
R8056:Myh7 UTSW 14 55,210,776 (GRCm39) nonsense probably null
R8061:Myh7 UTSW 14 55,228,398 (GRCm39) missense probably benign
R8101:Myh7 UTSW 14 55,210,776 (GRCm39) nonsense probably null
R8202:Myh7 UTSW 14 55,227,497 (GRCm39) missense probably benign
R8504:Myh7 UTSW 14 55,227,786 (GRCm39) missense probably damaging 0.98
R8560:Myh7 UTSW 14 55,213,405 (GRCm39) missense possibly damaging 0.93
R8843:Myh7 UTSW 14 55,212,752 (GRCm39) missense probably damaging 0.98
R8903:Myh7 UTSW 14 55,230,228 (GRCm39) nonsense probably null
R8926:Myh7 UTSW 14 55,222,533 (GRCm39) missense probably benign 0.33
R8936:Myh7 UTSW 14 55,228,440 (GRCm39) missense probably benign 0.00
R9182:Myh7 UTSW 14 55,226,374 (GRCm39) missense probably damaging 1.00
R9260:Myh7 UTSW 14 55,224,842 (GRCm39) missense probably damaging 0.99
R9264:Myh7 UTSW 14 55,213,454 (GRCm39) missense probably benign 0.01
R9288:Myh7 UTSW 14 55,222,932 (GRCm39) missense probably benign 0.35
R9362:Myh7 UTSW 14 55,222,932 (GRCm39) missense probably benign 0.00
R9497:Myh7 UTSW 14 55,217,841 (GRCm39) missense probably benign 0.12
R9561:Myh7 UTSW 14 55,216,146 (GRCm39) missense probably damaging 1.00
R9663:Myh7 UTSW 14 55,221,098 (GRCm39) missense probably damaging 1.00
R9789:Myh7 UTSW 14 55,229,384 (GRCm39) missense possibly damaging 0.87
Z1192:Myh7 UTSW 14 55,220,748 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGAGGTGACGTCATCCAG -3'
(R):5'- CGTGCTGTTCTCATAGACCAG -3'

Sequencing Primer
(F):5'- TGACGTCATCCAGCTCCAG -3'
(R):5'- AGACCAGGGATCTTTTAGAGCTCC -3'
Posted On 2018-03-15