Incidental Mutation 'R6274:Krt74'
ID507547
Institutional Source Beutler Lab
Gene Symbol Krt74
Ensembl Gene ENSMUSG00000067596
Gene Namekeratin 74
SynonymsKb37
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6274 (G1)
Quality Score224.009
Status Validated
Chromosome15
Chromosomal Location101754259-101763504 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 101763437 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000088018]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088018
SMART Domains Protein: ENSMUSP00000085335
Gene: ENSMUSG00000067596

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 102 9e-21 PFAM
Filament 105 418 6.41e-143 SMART
low complexity region 425 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229279
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Krt74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Krt74 APN 15 101756794 exon noncoding transcript
IGL02376:Krt74 APN 15 101754503 exon noncoding transcript
IGL02507:Krt74 APN 15 101760624 exon noncoding transcript
IGL03374:Krt74 APN 15 101760502 splice site noncoding transcript
R0032:Krt74 UTSW 15 101761452 exon noncoding transcript
R0032:Krt74 UTSW 15 101761452 exon noncoding transcript
R0110:Krt74 UTSW 15 101763316 exon noncoding transcript
R0450:Krt74 UTSW 15 101763316 exon noncoding transcript
R0469:Krt74 UTSW 15 101763316 exon noncoding transcript
R0510:Krt74 UTSW 15 101763316 exon noncoding transcript
R0550:Krt74 UTSW 15 101760679 splice site noncoding transcript
R0558:Krt74 UTSW 15 101760963 exon noncoding transcript
R1663:Krt74 UTSW 15 101756674 exon noncoding transcript
R2392:Krt74 UTSW 15 101756801 splice site noncoding transcript
R3772:Krt74 UTSW 15 101762195 exon noncoding transcript
R4167:Krt74 UTSW 15 101758869 exon noncoding transcript
R4670:Krt74 UTSW 15 101758869 exon noncoding transcript
R4741:Krt74 UTSW 15 101761441 exon noncoding transcript
R5470:Krt74 UTSW 15 101754465 exon noncoding transcript
R5639:Krt74 UTSW 15 101756760 exon noncoding transcript
R5664:Krt74 UTSW 15 101760579 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CTGCCAAACATGCTGTTGGC -3'
(R):5'- TTGCTCCAGTCCTTCTGAAG -3'

Sequencing Primer
(F):5'- GCAAAGCCACTCCCTCG -3'
(R):5'- ATAGTGGAGAGACGCCCTTTTCC -3'
Posted On2018-03-15