Incidental Mutation 'R6274:Fetub'
ID507549
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Namefetuin beta
Synonyms2310011O17Rik, D17980
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location22918334-22939778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22932331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 143 (R143C)
Ref Sequence ENSEMBL: ENSMUSP00000155898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
Predicted Effect probably damaging
Transcript: ENSMUST00000023587
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116625
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871
AA Change: R63C

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167399
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170805
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231768
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231880
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232097
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22935696 missense probably benign 0.29
IGL00843:Fetub APN 16 22929629 splice site probably benign
IGL01450:Fetub APN 16 22929236 missense probably benign 0.01
IGL01522:Fetub APN 16 22929641 start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22932328 missense probably damaging 1.00
IGL02745:Fetub APN 16 22937926 missense probably damaging 0.99
R0062:Fetub UTSW 16 22929086 intron probably benign
R0310:Fetub UTSW 16 22929756 splice site probably benign
R0508:Fetub UTSW 16 22929295 missense probably benign 0.01
R0604:Fetub UTSW 16 22935660 missense possibly damaging 0.78
R1560:Fetub UTSW 16 22939367 missense probably benign 0.00
R1844:Fetub UTSW 16 22935669 missense possibly damaging 0.94
R1896:Fetub UTSW 16 22932295 missense probably damaging 1.00
R3716:Fetub UTSW 16 22935693 missense probably damaging 1.00
R3717:Fetub UTSW 16 22935693 missense probably damaging 1.00
R4274:Fetub UTSW 16 22935679 missense probably damaging 1.00
R4751:Fetub UTSW 16 22937895 missense probably benign 0.02
R4941:Fetub UTSW 16 22937874 missense probably benign 0.01
R5468:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5470:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5690:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5692:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5781:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6193:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6195:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6244:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6245:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6273:Fetub UTSW 16 22932331 missense probably damaging 1.00
R7134:Fetub UTSW 16 22929257 missense possibly damaging 0.54
R7698:Fetub UTSW 16 22939309 missense probably benign 0.31
R7969:Fetub UTSW 16 22929699 missense possibly damaging 0.89
R8437:Fetub UTSW 16 22934235 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GCTAAAGAGTTCTCCCCACC -3'
(R):5'- GTGACTTAGGAAGGCTGTCC -3'

Sequencing Primer
(F):5'- ACACAGAACTGGATTTAAGTTTCAC -3'
(R):5'- TTAGGAAGGCTGTCCCCTGG -3'
Posted On2018-03-15