Incidental Mutation 'R6274:Fetub'
ID 507549
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Name fetuin beta
Synonyms 2310011O17Rik, D17980
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 22737132-22758518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22751081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 143 (R143C)
Ref Sequence ENSEMBL: ENSMUSP00000155898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
AlphaFold Q9QXC1
Predicted Effect probably damaging
Transcript: ENSMUST00000023587
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116625
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871
AA Change: R63C

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167399
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170805
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231768
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231880
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232097
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22,754,446 (GRCm39) missense probably benign 0.29
IGL00843:Fetub APN 16 22,748,379 (GRCm39) splice site probably benign
IGL01450:Fetub APN 16 22,747,986 (GRCm39) missense probably benign 0.01
IGL01522:Fetub APN 16 22,748,391 (GRCm39) start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22,751,078 (GRCm39) missense probably damaging 1.00
IGL02745:Fetub APN 16 22,756,676 (GRCm39) missense probably damaging 0.99
R0062:Fetub UTSW 16 22,747,836 (GRCm39) intron probably benign
R0310:Fetub UTSW 16 22,748,506 (GRCm39) splice site probably benign
R0508:Fetub UTSW 16 22,748,045 (GRCm39) missense probably benign 0.01
R0604:Fetub UTSW 16 22,754,410 (GRCm39) missense possibly damaging 0.78
R1560:Fetub UTSW 16 22,758,117 (GRCm39) missense probably benign 0.00
R1844:Fetub UTSW 16 22,754,419 (GRCm39) missense possibly damaging 0.94
R1896:Fetub UTSW 16 22,751,045 (GRCm39) missense probably damaging 1.00
R3716:Fetub UTSW 16 22,754,443 (GRCm39) missense probably damaging 1.00
R3717:Fetub UTSW 16 22,754,443 (GRCm39) missense probably damaging 1.00
R4274:Fetub UTSW 16 22,754,429 (GRCm39) missense probably damaging 1.00
R4751:Fetub UTSW 16 22,756,645 (GRCm39) missense probably benign 0.02
R4941:Fetub UTSW 16 22,756,624 (GRCm39) missense probably benign 0.01
R5468:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5470:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5690:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5692:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5781:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6038:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6038:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6039:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6039:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6193:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6195:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6244:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6245:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6273:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R7134:Fetub UTSW 16 22,748,007 (GRCm39) missense possibly damaging 0.54
R7698:Fetub UTSW 16 22,758,059 (GRCm39) missense probably benign 0.31
R7969:Fetub UTSW 16 22,748,449 (GRCm39) missense possibly damaging 0.89
R8437:Fetub UTSW 16 22,752,985 (GRCm39) missense possibly damaging 0.57
R8788:Fetub UTSW 16 22,758,182 (GRCm39) nonsense probably null
R8855:Fetub UTSW 16 22,758,321 (GRCm39) missense possibly damaging 0.61
R8866:Fetub UTSW 16 22,758,321 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCTAAAGAGTTCTCCCCACC -3'
(R):5'- GTGACTTAGGAAGGCTGTCC -3'

Sequencing Primer
(F):5'- ACACAGAACTGGATTTAAGTTTCAC -3'
(R):5'- TTAGGAAGGCTGTCCCCTGG -3'
Posted On 2018-03-15