Incidental Mutation 'R6274:Osbpl11'
ID507550
Institutional Source Beutler Lab
Gene Symbol Osbpl11
Ensembl Gene ENSMUSG00000022807
Gene Nameoxysterol binding protein-like 11
SynonymsORP-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location33185071-33243312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33227056 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 463 (I463N)
Ref Sequence ENSEMBL: ENSMUSP00000155873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039733] [ENSMUST00000232100] [ENSMUST00000232181]
Predicted Effect probably damaging
Transcript: ENSMUST00000039733
AA Change: I463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039632
Gene: ENSMUSG00000022807
AA Change: I463N

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
PH 70 168 2.03e-14 SMART
low complexity region 257 268 N/A INTRINSIC
Pfam:Oxysterol_BP 383 749 1.9e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231617
Predicted Effect probably damaging
Transcript: ENSMUST00000232100
AA Change: I457N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232181
AA Change: I463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9356 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Osbpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Osbpl11 APN 16 33241745 missense probably damaging 1.00
IGL01084:Osbpl11 APN 16 33226851 splice site probably benign
IGL03009:Osbpl11 APN 16 33241730 splice site probably benign
PIT4504001:Osbpl11 UTSW 16 33234494 missense probably benign 0.04
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0472:Osbpl11 UTSW 16 33234444 nonsense probably null
R0508:Osbpl11 UTSW 16 33196095 missense probably benign
R0609:Osbpl11 UTSW 16 33234444 nonsense probably null
R0715:Osbpl11 UTSW 16 33241730 splice site probably benign
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1275:Osbpl11 UTSW 16 33185850 missense probably benign 0.10
R1459:Osbpl11 UTSW 16 33236329 missense probably damaging 1.00
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1591:Osbpl11 UTSW 16 33209983 missense probably benign 0.00
R1752:Osbpl11 UTSW 16 33204835 missense probably damaging 1.00
R1883:Osbpl11 UTSW 16 33214353 missense probably benign
R1916:Osbpl11 UTSW 16 33185843 missense probably benign
R1916:Osbpl11 UTSW 16 33210095 missense possibly damaging 0.82
R4369:Osbpl11 UTSW 16 33224648 missense probably damaging 1.00
R4649:Osbpl11 UTSW 16 33196082 missense probably benign 0.12
R4873:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R4875:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R6074:Osbpl11 UTSW 16 33209965 missense probably benign 0.28
R7007:Osbpl11 UTSW 16 33226939 missense possibly damaging 0.81
R7399:Osbpl11 UTSW 16 33236279 missense probably benign
R7698:Osbpl11 UTSW 16 33234447 missense probably benign 0.04
R7814:Osbpl11 UTSW 16 33210061 nonsense probably null
R7934:Osbpl11 UTSW 16 33236382 missense probably damaging 1.00
Z1177:Osbpl11 UTSW 16 33227084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAAGCGTTCCTTACTG -3'
(R):5'- AGTCCAGACATGTGCATTTACAC -3'

Sequencing Primer
(F):5'- CCTTACTGGAGATGTACGCAG -3'
(R):5'- TCTGCATAAAATCCTGAGACTGGAG -3'
Posted On2018-03-15