Incidental Mutation 'R6274:Cfb'
ID 507552
Institutional Source Beutler Lab
Gene Symbol Cfb
Ensembl Gene ENSMUSG00000090231
Gene Name complement factor B
Synonyms FB, alternative-complement pathway C3/C5 convertase, B, Factor B, Bf, H2-Bf
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6274 (G1)
Quality Score 153.008
Status Validated
Chromosome 17
Chromosomal Location 35075350-35081492 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35081069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 7 (Q7R)
Ref Sequence ENSEMBL: ENSMUSP00000135660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000128767] [ENSMUST00000154526] [ENSMUST00000176203] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000153400] [ENSMUST00000152417]
AlphaFold P04186
Predicted Effect probably benign
Transcript: ENSMUST00000025229
AA Change: Q7R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231
AA Change: Q7R

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025230
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
AA Change: Q5R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231
AA Change: Q5R

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129891
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154526
AA Change: Q5R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231
AA Change: Q5R

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176203
AA Change: Q7R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231
AA Change: Q7R

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146299
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack the alternative complement pathway, and have reduced overall complement activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Cfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Cfb UTSW 17 35,079,362 (GRCm39) missense possibly damaging 0.92
R0419:Cfb UTSW 17 35,077,485 (GRCm39) missense probably damaging 1.00
R0514:Cfb UTSW 17 35,079,874 (GRCm39) missense probably damaging 1.00
R0645:Cfb UTSW 17 35,078,992 (GRCm39) missense probably benign 0.25
R0668:Cfb UTSW 17 35,076,079 (GRCm39) missense probably benign 0.29
R0893:Cfb UTSW 17 35,077,031 (GRCm39) missense probably damaging 1.00
R1879:Cfb UTSW 17 35,079,536 (GRCm39) missense probably benign 0.11
R2135:Cfb UTSW 17 35,076,254 (GRCm39) missense possibly damaging 0.84
R3107:Cfb UTSW 17 35,080,800 (GRCm39) missense possibly damaging 0.88
R4291:Cfb UTSW 17 35,080,114 (GRCm39) missense possibly damaging 0.95
R4369:Cfb UTSW 17 35,079,290 (GRCm39) missense probably damaging 1.00
R4371:Cfb UTSW 17 35,079,290 (GRCm39) missense probably damaging 1.00
R4616:Cfb UTSW 17 35,078,044 (GRCm39) missense probably benign 0.29
R5177:Cfb UTSW 17 35,078,002 (GRCm39) missense probably damaging 1.00
R5689:Cfb UTSW 17 35,080,770 (GRCm39) missense probably benign 0.00
R5773:Cfb UTSW 17 35,076,248 (GRCm39) nonsense probably null
R6046:Cfb UTSW 17 35,081,078 (GRCm39) splice site probably null
R6318:Cfb UTSW 17 35,080,800 (GRCm39) missense possibly damaging 0.88
R7035:Cfb UTSW 17 35,079,007 (GRCm39) missense possibly damaging 0.53
R7585:Cfb UTSW 17 35,076,737 (GRCm39) missense probably benign 0.00
R7920:Cfb UTSW 17 35,079,867 (GRCm39) missense probably benign 0.00
R8312:Cfb UTSW 17 35,077,121 (GRCm39) missense probably benign 0.11
R8465:Cfb UTSW 17 35,076,290 (GRCm39) nonsense probably null
R9452:Cfb UTSW 17 35,078,084 (GRCm39) missense probably benign
RF005:Cfb UTSW 17 35,077,022 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCCAGAGAGCAGGAGACTTG -3'
(R):5'- TGAATGTTCCGGGAAGCAGTG -3'

Sequencing Primer
(F):5'- AGCAGGAGACTTGGGGCC -3'
(R):5'- TGGCCAGGCTGCAGATG -3'
Posted On 2018-03-15