Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Mut'

507553

Institutional Source

Beutler Lab

Gene Symbol

Mut

Ensembl Gene

ENSMUSG00000023921

Gene Name

methylmalonyl-Coenzyme A mutase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40934685-40961989 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40956245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 570 (V570A)

Ref Sequence

ENSEMBL: ENSMUSP00000130941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169611]

AlphaFold

P16332

Predicted Effect

probably benign
Transcript: ENSMUST00000169611
AA Change: V570A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: V570A

Domain	Start	End	E-Value	Type
Pfam:MM_CoA_mutase	60	572	3.7e-240	PFAM
Pfam:B12-binding	613	731	4.7e-17	PFAM

Meta Mutation Damage Score

0.2023

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Mut

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01482:Mut	APN	17	40956271	missense	probably damaging	0.99
IGL01666:Mut	APN	17	40958811	missense	probably damaging	1.00
IGL02141:Mut	APN	17	40938817	missense	possibly damaging	0.68
IGL02257:Mut	APN	17	40938734	missense	possibly damaging	0.78
IGL02538:Mut	APN	17	40938619	missense	probably damaging	1.00
mix	UTSW	17	40941383	missense	possibly damaging	0.66
mongrel	UTSW	17	40938731	missense	possibly damaging	0.77
R0115:Mut	UTSW	17	40956227	missense	probably damaging	1.00
R0381:Mut	UTSW	17	40937258	missense	probably benign	0.04
R0603:Mut	UTSW	17	40947166	missense	probably damaging	0.99
R0928:Mut	UTSW	17	40937283	missense	probably benign	0.24
R1292:Mut	UTSW	17	40941407	missense	probably damaging	1.00
R1452:Mut	UTSW	17	40937468	splice site	probably benign
R1460:Mut	UTSW	17	40937375	missense	probably damaging	1.00
R2044:Mut	UTSW	17	40941451	missense	probably benign	0.00
R2256:Mut	UTSW	17	40956319	missense	probably benign	0.02
R2448:Mut	UTSW	17	40958841	missense	probably damaging	0.96
R3113:Mut	UTSW	17	40958356	missense	probably damaging	1.00
R3176:Mut	UTSW	17	40958872	splice site	probably null
R3276:Mut	UTSW	17	40958872	splice site	probably null
R3894:Mut	UTSW	17	40955139	missense	probably damaging	0.97
R4624:Mut	UTSW	17	40947055	missense	probably damaging	1.00
R4801:Mut	UTSW	17	40937351	missense	probably benign	0.08
R4802:Mut	UTSW	17	40937351	missense	probably benign	0.08
R5031:Mut	UTSW	17	40938827	missense	possibly damaging	0.96
R5394:Mut	UTSW	17	40947184	missense	probably benign	0.02
R5651:Mut	UTSW	17	40947111	missense	probably damaging	1.00
R6225:Mut	UTSW	17	40938731	missense	possibly damaging	0.77
R7002:Mut	UTSW	17	40941383	missense	possibly damaging	0.66
R7141:Mut	UTSW	17	40952839	missense	possibly damaging	0.68
R7203:Mut	UTSW	17	40938673	missense	probably benign	0.06
R7868:Mut	UTSW	17	40947043	missense	probably damaging	1.00
R8050:Mut	UTSW	17	40943893	missense	probably benign	0.06
R8228:Mut	UTSW	17	40937328	missense	possibly damaging	0.92
R8904:Mut	UTSW	17	40937393	missense	probably damaging	1.00
R8977:Mut	UTSW	17	40938590	missense	probably benign
R9182:Mut	UTSW	17	40941419	missense	probably damaging	1.00
RF021:Mut	UTSW	17	40951758	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCACTTTCATATACGTATTCTCAGG -3'
(R):5'- TCAAAGTTTCACATACTGGCAC -3'

Sequencing Primer
(F):5'- AACATTCTTGAGGTTTATACAGCC -3'
(R):5'- GTGTATTTCACAAGTAACAGGAACAC -3'

Posted On

2018-03-15