Incidental Mutation 'R6274:Olfr1451'
ID507555
Institutional Source Beutler Lab
Gene Symbol Olfr1451
Ensembl Gene ENSMUSG00000046913
Gene Nameolfactory receptor 1451
SynonymsGA_x6K02T2RE5P-3328502-3329434, MOR202-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12995014-13000417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12999870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 295 (V295I)
Ref Sequence ENSEMBL: ENSMUSP00000146874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063144] [ENSMUST00000207997]
Predicted Effect probably damaging
Transcript: ENSMUST00000063144
AA Change: V295I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049885
Gene: ENSMUSG00000046913
AA Change: V295I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 2.2e-5 PFAM
Pfam:7tm_1 39 289 6.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207997
AA Change: V295I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Olfr1451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1451 APN 19 12999319 missense probably damaging 1.00
IGL01301:Olfr1451 APN 19 12999417 missense probably damaging 0.99
IGL01369:Olfr1451 APN 19 12999761 missense possibly damaging 0.78
IGL02098:Olfr1451 APN 19 12999573 missense probably benign 0.00
IGL02106:Olfr1451 APN 19 12999565 missense possibly damaging 0.80
IGL02369:Olfr1451 APN 19 12999708 missense probably damaging 1.00
ANU18:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
R0316:Olfr1451 UTSW 19 12999402 missense probably damaging 1.00
R0926:Olfr1451 UTSW 19 12999190 missense probably damaging 1.00
R0988:Olfr1451 UTSW 19 12999787 missense probably benign 0.39
R1268:Olfr1451 UTSW 19 12999261 missense possibly damaging 0.80
R1509:Olfr1451 UTSW 19 12999451 missense possibly damaging 0.54
R1991:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2103:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2132:Olfr1451 UTSW 19 12999038 missense probably benign 0.21
R2206:Olfr1451 UTSW 19 12999040 missense probably benign 0.06
R3687:Olfr1451 UTSW 19 12999102 missense probably damaging 1.00
R4077:Olfr1451 UTSW 19 12999871 missense probably damaging 1.00
R4803:Olfr1451 UTSW 19 12999169 missense probably damaging 1.00
R4948:Olfr1451 UTSW 19 12999831 missense probably benign 0.06
R4999:Olfr1451 UTSW 19 12999219 missense probably benign 0.03
R6843:Olfr1451 UTSW 19 12998998 missense probably benign 0.09
R6928:Olfr1451 UTSW 19 12999838 missense probably damaging 0.99
R6941:Olfr1451 UTSW 19 12999497 missense possibly damaging 0.86
R7485:Olfr1451 UTSW 19 12999558 missense probably benign 0.03
R7611:Olfr1451 UTSW 19 12999067 missense possibly damaging 0.93
R7823:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCTTTGTCCACCTGTGCC -3'
(R):5'- GGTATGACAAGTAAATCCCGGAAATTC -3'

Sequencing Primer
(F):5'- GTGCCTCCCACCTCACTGTAG -3'
(R):5'- CGGAAATTCTTAAAATTTTCCTTGGC -3'
Posted On2018-03-15