Incidental Mutation 'R6274:Nrap'
ID 507556
Institutional Source Beutler Lab
Gene Symbol Nrap
Ensembl Gene ENSMUSG00000049134
Gene Name nebulin-related anchoring protein
Synonyms
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 56308473-56378466 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56350153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 655 (D655G)
Ref Sequence ENSEMBL: ENSMUSP00000073228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040711] [ENSMUST00000073536] [ENSMUST00000095947] [ENSMUST00000166203] [ENSMUST00000167239]
AlphaFold Q80XB4
Predicted Effect probably benign
Transcript: ENSMUST00000040711
AA Change: D620G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048364
Gene: ENSMUSG00000049134
AA Change: D620G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 1.76e-2 SMART
NEBU 1418 1448 2.09e0 SMART
NEBU 1453 1483 6.4e-5 SMART
NEBU 1489 1519 8.63e-1 SMART
NEBU 1527 1557 1.33e-2 SMART
NEBU 1562 1592 1.84e-5 SMART
NEBU 1593 1623 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073536
AA Change: D655G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073228
Gene: ENSMUSG00000049134
AA Change: D655G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.73e-10 SMART
NEBU 556 586 8.12e-7 SMART
NEBU 590 620 1.73e-1 SMART
NEBU 625 655 2.33e-7 SMART
NEBU 656 686 1.49e-5 SMART
NEBU 690 721 5.12e-4 SMART
NEBU 724 754 8.12e-7 SMART
NEBU 759 789 2.64e-6 SMART
NEBU 795 825 3.48e-6 SMART
NEBU 833 863 2.35e-3 SMART
NEBU 868 898 6.11e-2 SMART
NEBU 899 929 1.69e-4 SMART
NEBU 934 964 3.88e-4 SMART
NEBU 967 997 4e-6 SMART
NEBU 1002 1032 4.22e-5 SMART
NEBU 1038 1068 2.64e-6 SMART
NEBU 1076 1106 3.68e-5 SMART
NEBU 1111 1141 4.16e-4 SMART
NEBU 1142 1172 1.1e-3 SMART
NEBU 1177 1207 1.68e1 SMART
NEBU 1210 1240 4.59e-6 SMART
NEBU 1245 1275 4.06e-7 SMART
NEBU 1281 1311 1.99e-1 SMART
NEBU 1319 1349 1.85e-1 SMART
NEBU 1354 1384 1.39e-5 SMART
NEBU 1385 1415 4.03e-2 SMART
NEBU 1420 1450 1.76e-2 SMART
NEBU 1453 1483 2.09e0 SMART
NEBU 1488 1518 6.4e-5 SMART
NEBU 1524 1554 8.63e-1 SMART
NEBU 1562 1592 1.33e-2 SMART
NEBU 1597 1627 1.84e-5 SMART
NEBU 1628 1658 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095947
AA Change: D538G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093640
Gene: ENSMUSG00000049134
AA Change: D538G

DomainStartEndE-ValueType
NEBU 86 115 1.2e-6 SMART
NEBU 120 150 9.1e-8 SMART
NEBU 157 186 1.4e-6 SMART
NEBU 226 255 1.8e-8 SMART
NEBU 264 294 2.5e-5 SMART
NEBU 300 330 7.8e-6 SMART
NEBU 368 398 6e-11 SMART
NEBU 403 433 1.1e-12 SMART
NEBU 439 469 5.2e-9 SMART
NEBU 473 503 1.1e-3 SMART
NEBU 508 538 1.5e-9 SMART
NEBU 539 569 1e-7 SMART
NEBU 573 604 3.3e-6 SMART
NEBU 607 637 5.4e-9 SMART
NEBU 642 672 1.7e-8 SMART
NEBU 678 708 2.3e-8 SMART
NEBU 716 746 1.5e-5 SMART
NEBU 751 781 4.1e-4 SMART
NEBU 782 812 1.1e-6 SMART
NEBU 817 847 2.6e-6 SMART
NEBU 850 880 2.6e-8 SMART
NEBU 885 915 2.7e-7 SMART
NEBU 921 951 1.7e-8 SMART
NEBU 959 989 2.4e-7 SMART
NEBU 994 1024 2.7e-6 SMART
NEBU 1025 1055 7.2e-6 SMART
NEBU 1060 1090 1.1e-1 SMART
NEBU 1093 1123 3e-8 SMART
NEBU 1128 1158 2.6e-9 SMART
NEBU 1164 1194 1.3e-3 SMART
NEBU 1202 1232 1.2e-3 SMART
NEBU 1237 1267 8.8e-8 SMART
NEBU 1268 1298 2.7e-4 SMART
NEBU 1303 1333 1.2e-4 SMART
NEBU 1336 1366 1.4e-2 SMART
NEBU 1371 1401 4.3e-7 SMART
NEBU 1407 1437 5.6e-3 SMART
NEBU 1445 1475 8.8e-5 SMART
NEBU 1480 1510 1.2e-7 SMART
NEBU 1511 1541 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163160
Predicted Effect probably benign
Transcript: ENSMUST00000166203
AA Change: D619G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132582
Gene: ENSMUSG00000049134
AA Change: D619G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.06e-10 SMART
NEBU 554 584 1.73e-1 SMART
NEBU 589 619 2.33e-7 SMART
NEBU 620 650 1.49e-5 SMART
NEBU 654 685 5.12e-4 SMART
NEBU 688 718 8.12e-7 SMART
NEBU 723 753 2.64e-6 SMART
NEBU 759 789 3.48e-6 SMART
NEBU 797 827 2.35e-3 SMART
NEBU 832 862 6.11e-2 SMART
NEBU 863 893 1.69e-4 SMART
NEBU 898 928 3.88e-4 SMART
NEBU 931 961 4e-6 SMART
NEBU 966 996 4.22e-5 SMART
NEBU 1002 1032 2.64e-6 SMART
NEBU 1040 1070 3.68e-5 SMART
NEBU 1075 1105 4.16e-4 SMART
NEBU 1106 1136 1.1e-3 SMART
NEBU 1141 1171 1.68e1 SMART
NEBU 1174 1204 4.59e-6 SMART
NEBU 1209 1239 4.06e-7 SMART
NEBU 1245 1275 1.99e-1 SMART
NEBU 1283 1313 1.85e-1 SMART
NEBU 1318 1348 1.39e-5 SMART
NEBU 1349 1379 4.03e-2 SMART
NEBU 1384 1414 1.76e-2 SMART
NEBU 1417 1447 2.09e0 SMART
NEBU 1452 1482 6.4e-5 SMART
NEBU 1488 1518 8.63e-1 SMART
NEBU 1526 1556 1.33e-2 SMART
NEBU 1561 1591 1.84e-5 SMART
NEBU 1592 1622 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167239
AA Change: D620G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128196
Gene: ENSMUSG00000049134
AA Change: D620G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 3.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169099
SMART Domains Protein: ENSMUSP00000125889
Gene: ENSMUSG00000049134

DomainStartEndE-ValueType
NEBU 32 61 2.83e-6 SMART
NEBU 70 100 7.24e-4 SMART
NEBU 105 135 3.46e-1 SMART
NEBU 141 171 1.18e-3 SMART
NEBU 209 239 8.97e-9 SMART
NEBU 244 274 1.73e-10 SMART
NEBU 280 310 8.12e-7 SMART
NEBU 314 344 1.73e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Nrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Nrap APN 19 56,361,341 (GRCm39) missense probably damaging 1.00
IGL00570:Nrap APN 19 56,326,545 (GRCm39) missense probably benign 0.10
IGL00946:Nrap APN 19 56,329,058 (GRCm39) splice site probably null
IGL01070:Nrap APN 19 56,317,516 (GRCm39) missense probably damaging 1.00
IGL01111:Nrap APN 19 56,333,990 (GRCm39) missense probably damaging 1.00
IGL01138:Nrap APN 19 56,343,970 (GRCm39) missense probably damaging 1.00
IGL01290:Nrap APN 19 56,350,180 (GRCm39) missense probably damaging 1.00
IGL01352:Nrap APN 19 56,368,268 (GRCm39) missense probably benign 0.00
IGL01372:Nrap APN 19 56,317,534 (GRCm39) critical splice acceptor site probably null
IGL01395:Nrap APN 19 56,350,225 (GRCm39) missense probably damaging 1.00
IGL01413:Nrap APN 19 56,377,823 (GRCm39) missense probably damaging 0.99
IGL01734:Nrap APN 19 56,338,741 (GRCm39) missense probably damaging 1.00
IGL01933:Nrap APN 19 56,377,250 (GRCm39) missense probably damaging 1.00
IGL02156:Nrap APN 19 56,309,432 (GRCm39) missense probably damaging 1.00
IGL02415:Nrap APN 19 56,370,741 (GRCm39) missense probably damaging 1.00
IGL02447:Nrap APN 19 56,333,951 (GRCm39) nonsense probably null
IGL02864:Nrap APN 19 56,338,806 (GRCm39) missense probably damaging 1.00
IGL02993:Nrap APN 19 56,333,965 (GRCm39) missense probably damaging 1.00
IGL03003:Nrap APN 19 56,310,384 (GRCm39) missense probably damaging 1.00
IGL03006:Nrap APN 19 56,335,596 (GRCm39) missense probably benign 0.02
IGL03084:Nrap APN 19 56,353,886 (GRCm39) missense probably damaging 1.00
IGL03136:Nrap APN 19 56,330,687 (GRCm39) missense possibly damaging 0.69
IGL03272:Nrap APN 19 56,334,000 (GRCm39) intron probably benign
IGL03389:Nrap APN 19 56,340,148 (GRCm39) missense probably benign 0.10
R0116:Nrap UTSW 19 56,343,978 (GRCm39) missense probably damaging 1.00
R0374:Nrap UTSW 19 56,340,054 (GRCm39) missense probably damaging 1.00
R0715:Nrap UTSW 19 56,345,757 (GRCm39) missense probably damaging 0.98
R0828:Nrap UTSW 19 56,333,990 (GRCm39) missense probably damaging 1.00
R0883:Nrap UTSW 19 56,333,906 (GRCm39) missense probably damaging 1.00
R1416:Nrap UTSW 19 56,315,725 (GRCm39) missense possibly damaging 0.60
R1459:Nrap UTSW 19 56,372,562 (GRCm39) missense probably benign 0.00
R1616:Nrap UTSW 19 56,378,255 (GRCm39) missense probably damaging 1.00
R1676:Nrap UTSW 19 56,323,687 (GRCm39) missense probably damaging 1.00
R1687:Nrap UTSW 19 56,343,961 (GRCm39) missense probably damaging 0.99
R1766:Nrap UTSW 19 56,323,474 (GRCm39) missense probably damaging 0.99
R1792:Nrap UTSW 19 56,367,590 (GRCm39) missense probably benign 0.00
R1817:Nrap UTSW 19 56,372,487 (GRCm39) unclassified probably benign
R1972:Nrap UTSW 19 56,345,785 (GRCm39) missense probably damaging 1.00
R1982:Nrap UTSW 19 56,372,537 (GRCm39) missense probably damaging 0.99
R2258:Nrap UTSW 19 56,310,394 (GRCm39) missense possibly damaging 0.80
R2448:Nrap UTSW 19 56,310,462 (GRCm39) missense possibly damaging 0.90
R3034:Nrap UTSW 19 56,352,437 (GRCm39) missense probably damaging 1.00
R3801:Nrap UTSW 19 56,310,211 (GRCm39) missense probably damaging 1.00
R3804:Nrap UTSW 19 56,310,211 (GRCm39) missense probably damaging 1.00
R3923:Nrap UTSW 19 56,368,688 (GRCm39) missense probably damaging 0.99
R3964:Nrap UTSW 19 56,330,576 (GRCm39) missense probably damaging 1.00
R3965:Nrap UTSW 19 56,330,576 (GRCm39) missense probably damaging 1.00
R3966:Nrap UTSW 19 56,330,576 (GRCm39) missense probably damaging 1.00
R3980:Nrap UTSW 19 56,369,984 (GRCm39) missense probably benign 0.01
R4182:Nrap UTSW 19 56,338,759 (GRCm39) missense probably damaging 1.00
R4499:Nrap UTSW 19 56,339,913 (GRCm39) missense probably damaging 0.97
R4573:Nrap UTSW 19 56,330,770 (GRCm39) critical splice acceptor site probably null
R4603:Nrap UTSW 19 56,323,456 (GRCm39) critical splice donor site probably null
R4689:Nrap UTSW 19 56,374,458 (GRCm39) missense probably damaging 0.97
R4749:Nrap UTSW 19 56,368,669 (GRCm39) missense probably damaging 0.96
R4845:Nrap UTSW 19 56,339,902 (GRCm39) missense probably benign 0.16
R4937:Nrap UTSW 19 56,335,652 (GRCm39) missense probably damaging 1.00
R4962:Nrap UTSW 19 56,366,575 (GRCm39) missense probably damaging 1.00
R5156:Nrap UTSW 19 56,360,277 (GRCm39) missense possibly damaging 0.94
R5181:Nrap UTSW 19 56,333,960 (GRCm39) missense possibly damaging 0.85
R5202:Nrap UTSW 19 56,323,583 (GRCm39) missense probably damaging 1.00
R5262:Nrap UTSW 19 56,308,655 (GRCm39) missense possibly damaging 0.95
R5301:Nrap UTSW 19 56,367,541 (GRCm39) missense probably damaging 1.00
R5380:Nrap UTSW 19 56,370,035 (GRCm39) missense probably damaging 1.00
R5576:Nrap UTSW 19 56,310,414 (GRCm39) missense probably damaging 0.99
R5631:Nrap UTSW 19 56,342,553 (GRCm39) missense probably benign 0.19
R5754:Nrap UTSW 19 56,377,916 (GRCm39) missense possibly damaging 0.55
R5799:Nrap UTSW 19 56,330,601 (GRCm39) nonsense probably null
R5899:Nrap UTSW 19 56,329,006 (GRCm39) missense possibly damaging 0.80
R5910:Nrap UTSW 19 56,330,743 (GRCm39) missense probably benign 0.00
R5994:Nrap UTSW 19 56,340,031 (GRCm39) nonsense probably null
R6124:Nrap UTSW 19 56,374,458 (GRCm39) missense probably damaging 0.97
R6149:Nrap UTSW 19 56,377,885 (GRCm39) missense possibly damaging 0.79
R6182:Nrap UTSW 19 56,350,130 (GRCm39) missense probably benign
R6245:Nrap UTSW 19 56,368,307 (GRCm39) missense possibly damaging 0.80
R6245:Nrap UTSW 19 56,342,653 (GRCm39) missense probably damaging 1.00
R6270:Nrap UTSW 19 56,308,630 (GRCm39) missense probably benign 0.00
R6340:Nrap UTSW 19 56,335,616 (GRCm39) missense probably damaging 1.00
R6547:Nrap UTSW 19 56,339,998 (GRCm39) missense probably benign 0.00
R6734:Nrap UTSW 19 56,333,941 (GRCm39) missense probably damaging 0.99
R6770:Nrap UTSW 19 56,370,969 (GRCm39) splice site probably null
R6812:Nrap UTSW 19 56,340,108 (GRCm39) missense probably damaging 1.00
R6843:Nrap UTSW 19 56,368,651 (GRCm39) missense probably damaging 1.00
R7207:Nrap UTSW 19 56,333,953 (GRCm39) missense probably damaging 1.00
R7214:Nrap UTSW 19 56,366,567 (GRCm39) missense probably benign 0.09
R7313:Nrap UTSW 19 56,330,700 (GRCm39) missense probably damaging 0.97
R7515:Nrap UTSW 19 56,354,859 (GRCm39) missense possibly damaging 0.94
R7662:Nrap UTSW 19 56,308,715 (GRCm39) missense probably benign 0.00
R7819:Nrap UTSW 19 56,323,720 (GRCm39) missense probably benign
R7836:Nrap UTSW 19 56,338,729 (GRCm39) missense probably benign 0.00
R7895:Nrap UTSW 19 56,342,584 (GRCm39) missense probably benign 0.00
R8041:Nrap UTSW 19 56,352,768 (GRCm39) nonsense probably null
R8046:Nrap UTSW 19 56,308,683 (GRCm39) missense possibly damaging 0.46
R8066:Nrap UTSW 19 56,342,562 (GRCm39) missense possibly damaging 0.94
R8129:Nrap UTSW 19 56,355,068 (GRCm39) splice site probably null
R8188:Nrap UTSW 19 56,325,010 (GRCm39) nonsense probably null
R8323:Nrap UTSW 19 56,378,255 (GRCm39) missense probably benign 0.00
R8353:Nrap UTSW 19 56,312,352 (GRCm39) missense probably damaging 1.00
R8453:Nrap UTSW 19 56,312,352 (GRCm39) missense probably damaging 1.00
R8693:Nrap UTSW 19 56,310,384 (GRCm39) missense probably damaging 1.00
R8703:Nrap UTSW 19 56,323,703 (GRCm39) missense probably damaging 1.00
R8810:Nrap UTSW 19 56,352,843 (GRCm39) critical splice acceptor site probably benign
R8872:Nrap UTSW 19 56,308,627 (GRCm39) makesense probably null
R8980:Nrap UTSW 19 56,343,970 (GRCm39) missense probably damaging 1.00
R9201:Nrap UTSW 19 56,340,093 (GRCm39) missense probably damaging 1.00
R9229:Nrap UTSW 19 56,310,339 (GRCm39) missense probably benign 0.01
R9235:Nrap UTSW 19 56,330,760 (GRCm39) nonsense probably null
R9323:Nrap UTSW 19 56,378,255 (GRCm39) missense probably benign 0.00
R9327:Nrap UTSW 19 56,340,100 (GRCm39) missense probably benign 0.25
R9329:Nrap UTSW 19 56,350,277 (GRCm39) missense probably damaging 1.00
R9468:Nrap UTSW 19 56,330,632 (GRCm39) missense possibly damaging 0.52
R9517:Nrap UTSW 19 56,360,277 (GRCm39) missense probably benign 0.00
R9639:Nrap UTSW 19 56,333,948 (GRCm39) missense possibly damaging 0.63
R9657:Nrap UTSW 19 56,352,377 (GRCm39) missense probably benign 0.27
R9709:Nrap UTSW 19 56,317,453 (GRCm39) missense probably benign 0.08
R9709:Nrap UTSW 19 56,317,452 (GRCm39) missense probably damaging 0.98
X0028:Nrap UTSW 19 56,323,652 (GRCm39) nonsense probably null
Z1176:Nrap UTSW 19 56,333,949 (GRCm39) frame shift probably null
Z1177:Nrap UTSW 19 56,333,196 (GRCm39) missense probably benign 0.01
Z1177:Nrap UTSW 19 56,326,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCATCCTGAGTTTACAC -3'
(R):5'- AGAACAGCCTTTAATCAATGAGCC -3'

Sequencing Primer
(F):5'- GTCTATCCTGGACCTGTTACAG -3'
(R):5'- AATCAATGAGCCCTGTTTTGTTGC -3'
Posted On 2018-03-15