Incidental Mutation 'R6274:Araf'
ID507557
Institutional Source Beutler Lab
Gene Symbol Araf
Ensembl Gene ENSMUSG00000001127
Gene NameAraf proto-oncogene, serine/threonine kinase
Synonyms1200013E08Rik, Araf1, A-Raf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R6274 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location20797814-20860519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20860100 bp
ZygosityHomozygous
Amino Acid Change Arginine to Leucine at position 601 (R601L)
Ref Sequence ENSEMBL: ENSMUSP00000001155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001155] [ENSMUST00000081893] [ENSMUST00000115345] [ENSMUST00000136451]
Predicted Effect probably damaging
Transcript: ENSMUST00000001155
AA Change: R601L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001155
Gene: ENSMUSG00000001127
AA Change: R601L

DomainStartEndE-ValueType
RBD 19 91 1.46e-28 SMART
C1 99 144 7.68e-12 SMART
low complexity region 243 268 N/A INTRINSIC
Pfam:Pkinase_Tyr 308 565 1.9e-61 PFAM
Pfam:Pkinase 308 566 1.7e-56 PFAM
Pfam:Kinase-like 388 555 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081893
SMART Domains Protein: ENSMUSP00000080568
Gene: ENSMUSG00000037217

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 1.3e-23 PFAM
low complexity region 87 94 N/A INTRINSIC
Pfam:Synapsin 111 212 7.8e-47 PFAM
Pfam:Synapsin_C 214 416 3.2e-124 PFAM
low complexity region 427 440 N/A INTRINSIC
low complexity region 450 491 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 579 600 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115345
SMART Domains Protein: ENSMUSP00000111002
Gene: ENSMUSG00000037217

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 1.3e-23 PFAM
low complexity region 87 94 N/A INTRINSIC
Pfam:Synapsin 110 212 3.2e-60 PFAM
Pfam:Synapsin_C 214 416 1.1e-132 PFAM
Pfam:RimK 229 409 3.3e-8 PFAM
low complexity region 427 440 N/A INTRINSIC
low complexity region 450 491 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 579 600 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128250
AA Change: R199L
SMART Domains Protein: ENSMUSP00000119544
Gene: ENSMUSG00000001127
AA Change: R199L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 109 3.8e-15 PFAM
Pfam:Pkinase 16 109 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136451
SMART Domains Protein: ENSMUSP00000115793
Gene: ENSMUSG00000001127

DomainStartEndE-ValueType
RBD 56 128 1.46e-28 SMART
C1 136 181 7.68e-12 SMART
low complexity region 280 305 N/A INTRINSIC
Pfam:Pkinase_Tyr 345 401 2.3e-7 PFAM
Pfam:Pkinase 345 403 7.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176786
Meta Mutation Damage Score 0.1142 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous females or hemizygous males for a null targeted mutation show variable genetic background effects, from preweaning death, wasting, tremors, distended colon and small thymus to normal survival and breeding with mild neurological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Araf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02244:Araf APN X 20853596 splice site probably benign
IGL02484:Araf APN X 20853909 splice site probably benign
R1496:Araf UTSW X 20859704 missense probably damaging 1.00
R2228:Araf UTSW X 20851673 missense probably benign 0.30
R3732:Araf UTSW X 20850226 critical splice acceptor site probably benign
R6193:Araf UTSW X 20860100 missense probably damaging 0.98
R6194:Araf UTSW X 20860100 missense probably damaging 0.98
R6195:Araf UTSW X 20860100 missense probably damaging 0.98
R6242:Araf UTSW X 20860100 missense probably damaging 0.98
R6243:Araf UTSW X 20860100 missense probably damaging 0.98
R6244:Araf UTSW X 20860100 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATCTCTGGGACTCTGGACAC -3'
(R):5'- CTGAGTCACAGCCATTGGAG -3'

Sequencing Primer
(F):5'- TGGGACTCTGGACACCCCTC -3'
(R):5'- GCCATTGGAGATAAAACAGCTCTC -3'
Posted On2018-03-15