Mutagenetix > Incidental Mutations

Incidental Mutation 'R6275:Tnr'

507559

Institutional Source

Beutler Lab

Gene Symbol

Tnr

Ensembl Gene

ENSMUSG00000015829

Gene Name

tenascin R

Synonyms

TN-R, janusin, restrictin, J1-tenascin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159523769-159931729 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 159861270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 434 (Q434P)

Ref Sequence

ENSEMBL: ENSMUSP00000141553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]

AlphaFold

Q8BYI9

Predicted Effect

probably damaging
Transcript: ENSMUST00000111669
AA Change: Q434P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: Q434P

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192069
AA Change: Q434P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: Q434P

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000192457
AA Change: Q158P

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abca7	T	A	10: 79,997,791	L30H	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Itga10	A	G	3: 96,658,185	S1042G	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mov10l1	T	A	15: 89,026,620	I1071N	probably damaging	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stac3	T	A	10: 127,507,746	Y252*	probably null	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tanc1	A	T	2: 59,843,510	H1653L	probably benign	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Usp42	G	A	5: 143,714,972	R1099W	probably damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Tnr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tnr	APN	1	159861245	missense	probably benign	0.00
IGL00905:Tnr	APN	1	159852182	missense	probably benign	0.06
IGL01396:Tnr	APN	1	159897024	missense	possibly damaging	0.91
IGL01550:Tnr	APN	1	159874258	missense	probably benign
IGL01803:Tnr	APN	1	159868243	missense	probably damaging	1.00
IGL01845:Tnr	APN	1	159868006	unclassified	probably benign
IGL01983:Tnr	APN	1	159863779	missense	probably benign	0.00
IGL01985:Tnr	APN	1	159919037	missense	possibly damaging	0.70
IGL02210:Tnr	APN	1	159852101	missense	probably benign	0.44
IGL02486:Tnr	APN	1	159852094	splice site	probably null
IGL03210:Tnr	APN	1	159888310	missense	probably benign	0.00
Assiduous	UTSW	1	159892023	missense	probably benign
Persistent	UTSW	1	159852286	missense	probably benign
Tenacious	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0009:Tnr	UTSW	1	159852416	missense	probably damaging	1.00
R0042:Tnr	UTSW	1	159887025	missense	probably benign	0.01
R0594:Tnr	UTSW	1	159850335	missense	probably benign
R0617:Tnr	UTSW	1	159868103	missense	probably damaging	1.00
R0637:Tnr	UTSW	1	159850335	missense	possibly damaging	0.60
R0682:Tnr	UTSW	1	159852307	nonsense	probably null
R1171:Tnr	UTSW	1	159858210	missense	probably damaging	0.97
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1335:Tnr	UTSW	1	159868030	missense	probably benign	0.18
R1540:Tnr	UTSW	1	159850105	missense	probably damaging	0.99
R1697:Tnr	UTSW	1	159852030	missense	probably benign	0.00
R1938:Tnr	UTSW	1	159895037	nonsense	probably null
R1941:Tnr	UTSW	1	159850134	missense	possibly damaging	0.92
R2021:Tnr	UTSW	1	159852022	missense	probably benign
R2022:Tnr	UTSW	1	159852022	missense	probably benign
R2051:Tnr	UTSW	1	159892033	missense	probably benign
R2157:Tnr	UTSW	1	159858270	missense	probably damaging	0.98
R2319:Tnr	UTSW	1	159850048	start codon destroyed	probably null	1.00
R2936:Tnr	UTSW	1	159888362	missense	probably damaging	0.96
R3015:Tnr	UTSW	1	159888259	missense	probably benign	0.00
R3417:Tnr	UTSW	1	159895042	missense	probably benign	0.00
R3739:Tnr	UTSW	1	159923413	missense	possibly damaging	0.78
R3977:Tnr	UTSW	1	159892023	missense	probably benign
R4232:Tnr	UTSW	1	159886215	missense	possibly damaging	0.55
R4478:Tnr	UTSW	1	159884756	splice site	probably null
R4774:Tnr	UTSW	1	159897066	missense	probably damaging	1.00
R4829:Tnr	UTSW	1	159858404	missense	probably benign	0.24
R4837:Tnr	UTSW	1	159684788	intron	probably benign
R5111:Tnr	UTSW	1	159886228	missense	probably benign	0.04
R5224:Tnr	UTSW	1	159923315	missense	probably damaging	1.00
R5249:Tnr	UTSW	1	159684656	intron	probably benign
R5730:Tnr	UTSW	1	159888322	missense	probably benign	0.02
R5807:Tnr	UTSW	1	159886930	missense	possibly damaging	0.95
R5832:Tnr	UTSW	1	159886122	missense	probably benign	0.15
R5927:Tnr	UTSW	1	159912766	missense	probably damaging	1.00
R6049:Tnr	UTSW	1	159912754	missense	probably damaging	1.00
R6056:Tnr	UTSW	1	159886909	missense	probably damaging	0.99
R6063:Tnr	UTSW	1	159912684	missense	probably benign	0.00
R6141:Tnr	UTSW	1	159887122	missense	probably benign
R6218:Tnr	UTSW	1	159888314	missense	possibly damaging	0.94
R6543:Tnr	UTSW	1	159924107	missense	probably damaging	1.00
R6626:Tnr	UTSW	1	159850252	missense	probably damaging	1.00
R7378:Tnr	UTSW	1	159884862	critical splice donor site	probably null
R7587:Tnr	UTSW	1	159886208	missense	probably benign	0.27
R7766:Tnr	UTSW	1	159888310	missense	probably benign	0.00
R8140:Tnr	UTSW	1	159863695	missense	probably damaging	0.99
R8215:Tnr	UTSW	1	159888290	missense	possibly damaging	0.91
R8248:Tnr	UTSW	1	159892093	missense	probably damaging	0.98
R8374:Tnr	UTSW	1	159858383	missense	probably benign	0.24
R8427:Tnr	UTSW	1	159886231	missense	possibly damaging	0.67
R8465:Tnr	UTSW	1	159886075	missense	probably benign	0.01
R8534:Tnr	UTSW	1	159919015	missense	probably benign	0.18
R8753:Tnr	UTSW	1	159850366	missense	probably benign	0.28
R8804:Tnr	UTSW	1	159858312	missense	probably benign
R8857:Tnr	UTSW	1	159886158	missense	probably benign	0.10
R8917:Tnr	UTSW	1	159874122	nonsense	probably null
R8930:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8932:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8940:Tnr	UTSW	1	159858297	missense	probably damaging	1.00
R9096:Tnr	UTSW	1	159850234	missense	probably benign	0.10
R9127:Tnr	UTSW	1	159886110	missense	possibly damaging	0.68
R9205:Tnr	UTSW	1	159895047	missense	probably benign
R9311:Tnr	UTSW	1	159850093	missense	probably benign	0.30
X0011:Tnr	UTSW	1	159889338	missense	probably benign	0.02
X0028:Tnr	UTSW	1	159874114	missense	probably damaging	1.00
Z1088:Tnr	UTSW	1	159895095	missense	probably benign	0.29
Z1177:Tnr	UTSW	1	159852091	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGATTGTCCACTACACCTC -3'
(R):5'- CCTCTGGTTTGTGTGAGAACAG -3'

Sequencing Primer
(F):5'- TACACCTCTCCTCACCCAGG -3'
(R):5'- GTGTGAGAACAGTATCCTATAGCCC -3'

Posted On

2018-03-15