Mutagenetix > Incidental Mutation

Incidental Mutation 'R6275:Tanc1'

507560

Institutional Source

Beutler Lab

Gene Symbol

Tanc1

Ensembl Gene

ENSMUSG00000035168

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1

Synonyms

1200003E16Rik

MMRRC Submission

044445-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59612042-59846149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59843510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1653 (H1653L)

Ref Sequence

ENSEMBL: ENSMUSP00000123345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]

AlphaFold

Q0VGY8

Predicted Effect

probably benign
Transcript: ENSMUST00000037526
AA Change: H1653L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: H1653L

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112568
AA Change: H1646L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: H1646L

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	432	444	N/A	INTRINSIC
low complexity region	448	468	N/A	INTRINSIC
ANK	886	918	1.06e3	SMART
ANK	922	953	2.43e3	SMART
ANK	957	986	1.12e-3	SMART
Blast:ANK	990	1021	7e-12	BLAST
ANK	1030	1059	1.78e3	SMART
ANK	1068	1097	2.34e-1	SMART
ANK	1101	1130	3.71e-4	SMART
ANK	1134	1163	1.51e-4	SMART
ANK	1167	1196	4.89e-4	SMART
ANK	1200	1229	3.01e-4	SMART
ANK	1233	1262	1.99e2	SMART
TPR	1279	1312	7.49e1	SMART
TPR	1326	1359	2.35e-1	SMART
TPR	1360	1393	6.29e-2	SMART
low complexity region	1409	1425	N/A	INTRINSIC
low complexity region	1447	1476	N/A	INTRINSIC
low complexity region	1649	1679	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139863
AA Change: H1653L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: H1653L

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147650

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abca7	T	A	10: 79,997,791	L30H	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Itga10	A	G	3: 96,658,185	S1042G	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mov10l1	T	A	15: 89,026,620	I1071N	probably damaging	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stac3	T	A	10: 127,507,746	Y252*	probably null	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tnr	A	C	1: 159,861,270	Q434P	probably damaging	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Usp42	G	A	5: 143,714,972	R1099W	probably damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Tanc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Tanc1	APN	2	59790841	missense	possibly damaging	0.84
IGL00484:Tanc1	APN	2	59793176	missense	probably benign	0.00
IGL00688:Tanc1	APN	2	59815391	missense	probably damaging	1.00
IGL00765:Tanc1	APN	2	59806301	missense	probably benign	0.15
IGL01576:Tanc1	APN	2	59797735	missense	probably damaging	1.00
IGL01590:Tanc1	APN	2	59785473	missense	probably benign
IGL02016:Tanc1	APN	2	59843590	missense	probably benign	0.00
IGL02373:Tanc1	APN	2	59796028	critical splice donor site	probably null
IGL02539:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02540:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02541:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02543:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02559:Tanc1	APN	2	59724654	splice site	probably benign
IGL02626:Tanc1	APN	2	59799872	missense	probably damaging	1.00
IGL02669:Tanc1	APN	2	59799986	missense	probably damaging	1.00
IGL02902:Tanc1	APN	2	59793087	splice site	probably benign
Oreja	UTSW	2	59791804	synonymous	silent
R0178:Tanc1	UTSW	2	59835447	nonsense	probably null
R0347:Tanc1	UTSW	2	59842991	missense	probably benign
R0570:Tanc1	UTSW	2	59796038	splice site	probably benign
R0660:Tanc1	UTSW	2	59843884	nonsense	probably null
R0664:Tanc1	UTSW	2	59843884	nonsense	probably null
R0898:Tanc1	UTSW	2	59790788	missense	probably damaging	1.00
R1333:Tanc1	UTSW	2	59843491	missense	probably benign
R1575:Tanc1	UTSW	2	59791651	missense	probably damaging	1.00
R1608:Tanc1	UTSW	2	59797694	missense	possibly damaging	0.80
R1616:Tanc1	UTSW	2	59785387	missense	probably damaging	1.00
R1703:Tanc1	UTSW	2	59843021	missense	probably benign	0.02
R1727:Tanc1	UTSW	2	59790809	missense	probably damaging	1.00
R1809:Tanc1	UTSW	2	59800097	missense	probably damaging	1.00
R1812:Tanc1	UTSW	2	59791679	missense	probably damaging	1.00
R1925:Tanc1	UTSW	2	59724751	missense	possibly damaging	0.48
R1951:Tanc1	UTSW	2	59791812	missense	possibly damaging	0.92
R2174:Tanc1	UTSW	2	59843833	missense	possibly damaging	0.72
R2228:Tanc1	UTSW	2	59724724	missense	probably benign	0.04
R2267:Tanc1	UTSW	2	59837219	critical splice donor site	probably null
R4191:Tanc1	UTSW	2	59839013	missense	probably damaging	1.00
R4476:Tanc1	UTSW	2	59841996	splice site	probably null
R4632:Tanc1	UTSW	2	59795835	missense	probably damaging	1.00
R4825:Tanc1	UTSW	2	59699422	missense	probably damaging	1.00
R4982:Tanc1	UTSW	2	59799943	missense	probably damaging	1.00
R5338:Tanc1	UTSW	2	59795834	missense	probably damaging	1.00
R5657:Tanc1	UTSW	2	59834707	splice site	probably null
R5672:Tanc1	UTSW	2	59772353	missense	possibly damaging	0.81
R5703:Tanc1	UTSW	2	59795997	missense	probably damaging	0.98
R5707:Tanc1	UTSW	2	59758530	missense	probably benign
R5778:Tanc1	UTSW	2	59699347	critical splice acceptor site	probably null
R5795:Tanc1	UTSW	2	59807582	missense	possibly damaging	0.62
R5831:Tanc1	UTSW	2	59785341	missense	possibly damaging	0.89
R5849:Tanc1	UTSW	2	59799904	missense	probably benign	0.00
R5912:Tanc1	UTSW	2	59791686	missense	possibly damaging	0.92
R5944:Tanc1	UTSW	2	59837220	critical splice donor site	probably null
R6057:Tanc1	UTSW	2	59817493	missense	possibly damaging	0.46
R6142:Tanc1	UTSW	2	59833222	nonsense	probably null
R6179:Tanc1	UTSW	2	59842976	missense	probably benign	0.42
R6185:Tanc1	UTSW	2	59791585	splice site	probably null
R6192:Tanc1	UTSW	2	59838961	splice site	probably null
R6196:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6197:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6230:Tanc1	UTSW	2	59842031	missense	probably damaging	1.00
R6415:Tanc1	UTSW	2	59837114	missense	probably benign	0.02
R6480:Tanc1	UTSW	2	59807642	missense	probably damaging	1.00
R6578:Tanc1	UTSW	2	59795954	missense	probably damaging	1.00
R6786:Tanc1	UTSW	2	59791806	missense	probably benign	0.00
R7006:Tanc1	UTSW	2	59795844	missense	probably damaging	1.00
R7133:Tanc1	UTSW	2	59797609	missense	probably benign	0.16
R7381:Tanc1	UTSW	2	59785326	missense	probably damaging	1.00
R7422:Tanc1	UTSW	2	59806344	missense	probably benign	0.02
R8392:Tanc1	UTSW	2	59806307	missense	probably damaging	0.99
R8692:Tanc1	UTSW	2	59843645	missense	probably benign	0.01
R8730:Tanc1	UTSW	2	59771246	missense	probably benign	0.00
R8731:Tanc1	UTSW	2	59843252	missense	probably benign	0.01
R8813:Tanc1	UTSW	2	59799921	missense	probably damaging	1.00
R8815:Tanc1	UTSW	2	59790841	missense	possibly damaging	0.84
R8933:Tanc1	UTSW	2	59785456	missense	possibly damaging	0.92
R9015:Tanc1	UTSW	2	59791880	missense	probably benign
R9042:Tanc1	UTSW	2	59843422	missense	probably benign	0.00
R9154:Tanc1	UTSW	2	59799788	missense	probably damaging	1.00
R9269:Tanc1	UTSW	2	59800088	missense	probably damaging	1.00
R9283:Tanc1	UTSW	2	59799830	missense	probably damaging	0.99
R9380:Tanc1	UTSW	2	59835452	missense	probably damaging	1.00
R9422:Tanc1	UTSW	2	59807589	missense	probably benign	0.08
R9428:Tanc1	UTSW	2	59771204	missense	probably damaging	1.00
R9694:Tanc1	UTSW	2	59795852	missense	probably damaging	1.00
RF028:Tanc1	UTSW	2	59843269	small deletion	probably benign
RF049:Tanc1	UTSW	2	59843269	small deletion	probably benign
X0063:Tanc1	UTSW	2	59843980	nonsense	probably null
X0064:Tanc1	UTSW	2	59844112	missense	probably damaging	1.00
Z1176:Tanc1	UTSW	2	59772529	missense	possibly damaging	0.93
Z1177:Tanc1	UTSW	2	59790887	missense	probably benign
Z1177:Tanc1	UTSW	2	59791830	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGGTTGTGGCCACTTCG -3'
(R):5'- CTTGTCCATGATGCCCATAAATG -3'

Sequencing Primer
(F):5'- TGTGGCCACTTCGGGGATC -3'
(R):5'- CATAAATGGAGTGTTGCGGGGC -3'

Posted On

2018-03-15