Incidental Mutation 'R6275:Tanc1'
ID 507560
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Name tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms 1200003E16Rik
MMRRC Submission 044445-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6275 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 59612042-59846149 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59843510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1653 (H1653L)
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
AlphaFold Q0VGY8
Predicted Effect probably benign
Transcript: ENSMUST00000037526
AA Change: H1653L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: H1653L

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112568
AA Change: H1646L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: H1646L

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139863
AA Change: H1653L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: H1653L

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147650
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
R8392:Tanc1 UTSW 2 59806307 missense probably damaging 0.99
R8692:Tanc1 UTSW 2 59843645 missense probably benign 0.01
R8730:Tanc1 UTSW 2 59771246 missense probably benign 0.00
R8731:Tanc1 UTSW 2 59843252 missense probably benign 0.01
R8813:Tanc1 UTSW 2 59799921 missense probably damaging 1.00
R8815:Tanc1 UTSW 2 59790841 missense possibly damaging 0.84
R8933:Tanc1 UTSW 2 59785456 missense possibly damaging 0.92
R9015:Tanc1 UTSW 2 59791880 missense probably benign
R9042:Tanc1 UTSW 2 59843422 missense probably benign 0.00
R9154:Tanc1 UTSW 2 59799788 missense probably damaging 1.00
R9269:Tanc1 UTSW 2 59800088 missense probably damaging 1.00
R9283:Tanc1 UTSW 2 59799830 missense probably damaging 0.99
R9380:Tanc1 UTSW 2 59835452 missense probably damaging 1.00
R9422:Tanc1 UTSW 2 59807589 missense probably benign 0.08
R9428:Tanc1 UTSW 2 59771204 missense probably damaging 1.00
R9694:Tanc1 UTSW 2 59795852 missense probably damaging 1.00
RF028:Tanc1 UTSW 2 59843269 small deletion probably benign
RF049:Tanc1 UTSW 2 59843269 small deletion probably benign
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59772529 missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59790887 missense probably benign
Z1177:Tanc1 UTSW 2 59791830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGTTGTGGCCACTTCG -3'
(R):5'- CTTGTCCATGATGCCCATAAATG -3'

Sequencing Primer
(F):5'- TGTGGCCACTTCGGGGATC -3'
(R):5'- CATAAATGGAGTGTTGCGGGGC -3'
Posted On 2018-03-15