Mutagenetix > Incidental Mutation

Incidental Mutation 'R6275:Itga10'

507564

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R6275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96658185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1042 (S1042G)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365]

AlphaFold

E9Q6R1

Predicted Effect

probably benign
Transcript: ENSMUST00000029744
AA Change: S1043G

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: S1043G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119365
AA Change: S1042G

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: S1042G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127607

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abca7	T	A	10: 79,997,791	L30H	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mov10l1	T	A	15: 89,026,620	I1071N	probably damaging	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stac3	T	A	10: 127,507,746	Y252*	probably null	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tanc1	A	T	2: 59,843,510	H1653L	probably benign	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tnr	A	C	1: 159,861,270	Q434P	probably damaging	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Usp42	G	A	5: 143,714,972	R1099W	probably damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GACCTTTCTCTAGGCAAGCTG -3'
(R):5'- ATGAGTTTATGTGCCTCCAGAG -3'

Sequencing Primer
(F):5'- TGCAGAACCTGACTGAGCC -3'
(R):5'- CCAGAGCCCGGTTAGTGTTTC -3'

Posted On

2018-03-15