Incidental Mutation 'R6275:Ermap'
ID507568
Institutional Source Beutler Lab
Gene Symbol Ermap
Ensembl Gene ENSMUSG00000028644
Gene Nameerythroblast membrane-associated protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119175457-119190011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119178550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 414 (V414M)
Ref Sequence ENSEMBL: ENSMUSP00000123426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030396] [ENSMUST00000052715] [ENSMUST00000106355] [ENSMUST00000138395] [ENSMUST00000154226] [ENSMUST00000179290]
Predicted Effect probably benign
Transcript: ENSMUST00000030396
SMART Domains Protein: ENSMUSP00000030396
Gene: ENSMUSG00000028644

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Blast:IG_like 174 260 1e-19 BLAST
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052715
SMART Domains Protein: ENSMUSP00000053013
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106355
SMART Domains Protein: ENSMUSP00000101962
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137080
Predicted Effect probably damaging
Transcript: ENSMUST00000138395
AA Change: V414M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123426
Gene: ENSMUSG00000028644
AA Change: V414M

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
coiled coil region 304 342 N/A INTRINSIC
PRY 354 406 1.15e-27 SMART
SPRY 407 532 3.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154226
Predicted Effect probably benign
Transcript: ENSMUST00000179290
SMART Domains Protein: ENSMUSP00000136119
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Meta Mutation Damage Score 0.3015 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Ermap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ermap APN 4 119183917 missense probably damaging 1.00
IGL01402:Ermap APN 4 119187158 missense probably damaging 1.00
IGL02471:Ermap APN 4 119179963 missense probably damaging 0.99
IGL02696:Ermap APN 4 119187707 missense possibly damaging 0.89
IGL02806:Ermap APN 4 119188916 missense possibly damaging 0.91
R0017:Ermap UTSW 4 119179948 splice site probably benign
R0645:Ermap UTSW 4 119185691 missense probably benign 0.04
R0737:Ermap UTSW 4 119178510 missense probably damaging 1.00
R1204:Ermap UTSW 4 119188867 missense possibly damaging 0.91
R1239:Ermap UTSW 4 119188925 missense probably benign
R1351:Ermap UTSW 4 119181361 splice site probably null
R1597:Ermap UTSW 4 119183955 missense probably damaging 1.00
R4128:Ermap UTSW 4 119187111 missense possibly damaging 0.89
R4588:Ermap UTSW 4 119188248 intron probably benign
R4853:Ermap UTSW 4 119187254 missense probably damaging 1.00
R4906:Ermap UTSW 4 119188818 intron probably benign
R4946:Ermap UTSW 4 119183308 missense probably damaging 1.00
R5187:Ermap UTSW 4 119185818 critical splice acceptor site probably null
R6301:Ermap UTSW 4 119185603 missense probably damaging 1.00
R6458:Ermap UTSW 4 119178140 missense probably damaging 1.00
R6896:Ermap UTSW 4 119187131 nonsense probably null
R6997:Ermap UTSW 4 119178613 missense probably damaging 1.00
R7445:Ermap UTSW 4 119188710 missense unknown
R8193:Ermap UTSW 4 119183943 missense possibly damaging 0.87
Z1177:Ermap UTSW 4 119185561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTTTGAGGCGGAAGGAG -3'
(R):5'- CCCTCCAAATCTACTGGGAGATTC -3'

Sequencing Primer
(F):5'- CTTTGAGGCGGAAGGAGGTCTG -3'
(R):5'- TCTCTAATTCTCTGCAGTGGC -3'
Posted On2018-03-15