Incidental Mutation 'R6275:Usp42'
ID507571
Institutional Source Beutler Lab
Gene Symbol Usp42
Ensembl Gene ENSMUSG00000051306
Gene Nameubiquitin specific peptidase 42
SynonymsA630018G05Rik, D5Ertd591e, 3110031A07Rik, 2410140K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143710325-143732280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143714972 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1099 (R1099W)
Ref Sequence ENSEMBL: ENSMUSP00000053955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053287] [ENSMUST00000116456]
Predicted Effect probably damaging
Transcript: ENSMUST00000053287
AA Change: R1099W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306
AA Change: R1099W

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
Pfam:UCH 109 408 1.4e-46 PFAM
Pfam:UCH_1 110 391 1.4e-18 PFAM
low complexity region 470 490 N/A INTRINSIC
low complexity region 567 579 N/A INTRINSIC
low complexity region 604 613 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 954 962 N/A INTRINSIC
low complexity region 1016 1031 N/A INTRINSIC
low complexity region 1201 1219 N/A INTRINSIC
low complexity region 1239 1255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116456
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155408
Meta Mutation Damage Score 0.5169 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit fecundity and behavioral abnormalities, hyperactivity, increased T cell number, abnormal lens morphology, and cataracts. Males display oligozoospermia and testis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Usp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Usp42 APN 5 143717142 missense probably benign 0.00
IGL00902:Usp42 APN 5 143719874 splice site probably benign
IGL01326:Usp42 APN 5 143721215 missense possibly damaging 0.54
IGL01985:Usp42 APN 5 143715185 missense probably damaging 1.00
IGL02629:Usp42 APN 5 143723154 missense possibly damaging 0.94
IGL02683:Usp42 APN 5 143715346 missense possibly damaging 0.55
IGL02700:Usp42 APN 5 143717128 missense probably benign 0.01
IGL02965:Usp42 APN 5 143728014 missense probably damaging 1.00
PIT4468001:Usp42 UTSW 5 143714644 missense probably damaging 1.00
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0420:Usp42 UTSW 5 143714861 missense probably damaging 0.99
R1066:Usp42 UTSW 5 143718041 missense probably damaging 1.00
R1345:Usp42 UTSW 5 143717333 missense probably damaging 1.00
R1628:Usp42 UTSW 5 143717367 missense probably damaging 1.00
R1728:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1729:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1767:Usp42 UTSW 5 143714866 missense possibly damaging 0.69
R1772:Usp42 UTSW 5 143717102 missense probably damaging 1.00
R1784:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1916:Usp42 UTSW 5 143715056 missense probably damaging 1.00
R2425:Usp42 UTSW 5 143715839 missense probably benign 0.09
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2886:Usp42 UTSW 5 143721629 splice site probably benign
R3195:Usp42 UTSW 5 143717199 missense probably benign 0.02
R3737:Usp42 UTSW 5 143715439 missense probably benign 0.00
R3738:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4034:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4795:Usp42 UTSW 5 143723937 missense probably damaging 1.00
R4940:Usp42 UTSW 5 143719762 missense probably damaging 1.00
R4967:Usp42 UTSW 5 143715364 missense possibly damaging 0.71
R5282:Usp42 UTSW 5 143721646 missense probably damaging 1.00
R5773:Usp42 UTSW 5 143713712 missense probably benign 0.03
R5778:Usp42 UTSW 5 143719576 missense probably damaging 1.00
R5933:Usp42 UTSW 5 143715515 missense probably benign 0.00
R6192:Usp42 UTSW 5 143717187 missense possibly damaging 0.73
R6496:Usp42 UTSW 5 143715103 missense probably damaging 1.00
R6825:Usp42 UTSW 5 143727807 missense probably damaging 1.00
R6939:Usp42 UTSW 5 143727969 missense probably damaging 1.00
R7099:Usp42 UTSW 5 143726645 missense probably damaging 1.00
R7356:Usp42 UTSW 5 143717087 missense possibly damaging 0.56
R7876:Usp42 UTSW 5 143721671 missense probably damaging 1.00
R7959:Usp42 UTSW 5 143721671 missense probably damaging 1.00
X0022:Usp42 UTSW 5 143716060 frame shift probably null
X0027:Usp42 UTSW 5 143717078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCATGAAAGCGCTCAGGG -3'
(R):5'- CCACTCACGGATTAGGAGTG -3'

Sequencing Primer
(F):5'- GAGACTGTGGCTGCTGTCC -3'
(R):5'- AGCCGGTACCACCATTTG -3'
Posted On2018-03-15