Mutagenetix > Incidental Mutations

Incidental Mutation 'R6275:Usp42'

507571

Institutional Source

Beutler Lab

Gene Symbol

Usp42

Ensembl Gene

ENSMUSG00000051306

Gene Name

ubiquitin specific peptidase 42

Synonyms

A630018G05Rik, D5Ertd591e, 3110031A07Rik, 2410140K03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143710325-143732280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 143714972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 1099 (R1099W)

Ref Sequence

ENSEMBL: ENSMUSP00000053955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053287] [ENSMUST00000116456]

AlphaFold

B2RQC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000053287
AA Change: R1099W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306
AA Change: R1099W

Domain	Start	End	E-Value	Type
low complexity region	65	77	N/A	INTRINSIC
Pfam:UCH	109	408	1.4e-46	PFAM
Pfam:UCH_1	110	391	1.4e-18	PFAM
low complexity region	470	490	N/A	INTRINSIC
low complexity region	567	579	N/A	INTRINSIC
low complexity region	604	613	N/A	INTRINSIC
low complexity region	634	645	N/A	INTRINSIC
low complexity region	954	962	N/A	INTRINSIC
low complexity region	1016	1031	N/A	INTRINSIC
low complexity region	1201	1219	N/A	INTRINSIC
low complexity region	1239	1255	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000116456

SMART Domains

Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001

Domain	Start	End	E-Value	Type
low complexity region	3	10	N/A	INTRINSIC
low complexity region	14	35	N/A	INTRINSIC
Sec7	63	248	3.21e-104	SMART
PH	265	382	2.36e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141225

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141396

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155408

Meta Mutation Damage Score

0.5169

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit fecundity and behavioral abnormalities, hyperactivity, increased T cell number, abnormal lens morphology, and cataracts. Males display oligozoospermia and testis degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abca7	T	A	10: 79,997,791	L30H	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Itga10	A	G	3: 96,658,185	S1042G	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mov10l1	T	A	15: 89,026,620	I1071N	probably damaging	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stac3	T	A	10: 127,507,746	Y252*	probably null	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tanc1	A	T	2: 59,843,510	H1653L	probably benign	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tnr	A	C	1: 159,861,270	Q434P	probably damaging	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Usp42

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Usp42	APN	5	143717142	missense	probably benign	0.00
IGL00902:Usp42	APN	5	143719874	splice site	probably benign
IGL01326:Usp42	APN	5	143721215	missense	possibly damaging	0.54
IGL01985:Usp42	APN	5	143715185	missense	probably damaging	1.00
IGL02629:Usp42	APN	5	143723154	missense	possibly damaging	0.94
IGL02683:Usp42	APN	5	143715346	missense	possibly damaging	0.55
IGL02700:Usp42	APN	5	143717128	missense	probably benign	0.01
IGL02965:Usp42	APN	5	143728014	missense	probably damaging	1.00
PIT4468001:Usp42	UTSW	5	143714644	missense	probably damaging	1.00
R0043:Usp42	UTSW	5	143714710	missense	probably benign	0.09
R0043:Usp42	UTSW	5	143714710	missense	probably benign	0.09
R0420:Usp42	UTSW	5	143714861	missense	probably damaging	0.99
R1066:Usp42	UTSW	5	143718041	missense	probably damaging	1.00
R1345:Usp42	UTSW	5	143717333	missense	probably damaging	1.00
R1628:Usp42	UTSW	5	143717367	missense	probably damaging	1.00
R1728:Usp42	UTSW	5	143714626	missense	probably damaging	1.00
R1729:Usp42	UTSW	5	143714626	missense	probably damaging	1.00
R1767:Usp42	UTSW	5	143714866	missense	possibly damaging	0.69
R1772:Usp42	UTSW	5	143717102	missense	probably damaging	1.00
R1784:Usp42	UTSW	5	143714626	missense	probably damaging	1.00
R1916:Usp42	UTSW	5	143715056	missense	probably damaging	1.00
R2425:Usp42	UTSW	5	143715839	missense	probably benign	0.09
R2867:Usp42	UTSW	5	143715464	missense	possibly damaging	0.52
R2867:Usp42	UTSW	5	143715464	missense	possibly damaging	0.52
R2886:Usp42	UTSW	5	143721629	splice site	probably benign
R3195:Usp42	UTSW	5	143717199	missense	probably benign	0.02
R3737:Usp42	UTSW	5	143715439	missense	probably benign	0.00
R3738:Usp42	UTSW	5	143715439	missense	probably benign	0.00
R4034:Usp42	UTSW	5	143715439	missense	probably benign	0.00
R4795:Usp42	UTSW	5	143723937	missense	probably damaging	1.00
R4940:Usp42	UTSW	5	143719762	missense	probably damaging	1.00
R4967:Usp42	UTSW	5	143715364	missense	possibly damaging	0.71
R5282:Usp42	UTSW	5	143721646	missense	probably damaging	1.00
R5773:Usp42	UTSW	5	143713712	missense	probably benign	0.03
R5778:Usp42	UTSW	5	143719576	missense	probably damaging	1.00
R5933:Usp42	UTSW	5	143715515	missense	probably benign	0.00
R6192:Usp42	UTSW	5	143717187	missense	possibly damaging	0.73
R6496:Usp42	UTSW	5	143715103	missense	probably damaging	1.00
R6825:Usp42	UTSW	5	143727807	missense	probably damaging	1.00
R6939:Usp42	UTSW	5	143727969	missense	probably damaging	1.00
R7099:Usp42	UTSW	5	143726645	missense	probably damaging	1.00
R7356:Usp42	UTSW	5	143717087	missense	possibly damaging	0.56
R7876:Usp42	UTSW	5	143721671	missense	probably damaging	1.00
R8243:Usp42	UTSW	5	143715094	missense	probably benign	0.01
R8554:Usp42	UTSW	5	143720382	missense	probably damaging	0.98
R8716:Usp42	UTSW	5	143717941	missense	probably damaging	1.00
R8854:Usp42	UTSW	5	143716877	missense	possibly damaging	0.93
R8886:Usp42	UTSW	5	143714959	missense	probably damaging	1.00
R8917:Usp42	UTSW	5	143715940	missense
R9027:Usp42	UTSW	5	143723151	missense	probably damaging	1.00
R9062:Usp42	UTSW	5	143717985	missense	possibly damaging	0.92
R9283:Usp42	UTSW	5	143719509	missense	probably damaging	1.00
R9354:Usp42	UTSW	5	143715272	missense	probably benign	0.00
X0022:Usp42	UTSW	5	143716060	frame shift	probably null
X0027:Usp42	UTSW	5	143717078	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTTCATGAAAGCGCTCAGGG -3'
(R):5'- CCACTCACGGATTAGGAGTG -3'

Sequencing Primer
(F):5'- GAGACTGTGGCTGCTGTCC -3'
(R):5'- AGCCGGTACCACCATTTG -3'

Posted On

2018-03-15