Incidental Mutation 'R6275:Ccdc81'
ID507576
Institutional Source Beutler Lab
Gene Symbol Ccdc81
Ensembl Gene ENSMUSG00000039391
Gene Namecoiled-coil domain containing 81
Synonyms4921513D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location89866148-89903629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89882311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 318 (D318G)
Ref Sequence ENSEMBL: ENSMUSP00000044087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041195] [ENSMUST00000131966]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041195
AA Change: D318G

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044087
Gene: ENSMUSG00000039391
AA Change: D318G

DomainStartEndE-ValueType
Pfam:DUF4496 29 165 2.7e-47 PFAM
low complexity region 224 233 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
coiled coil region 434 468 N/A INTRINSIC
low complexity region 623 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131966
SMART Domains Protein: ENSMUSP00000117788
Gene: ENSMUSG00000039391

DomainStartEndE-ValueType
Pfam:DUF4496 28 165 2e-41 PFAM
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Ccdc81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc81 APN 7 89869615 splice site probably benign
IGL01948:Ccdc81 APN 7 89875855 missense possibly damaging 0.80
IGL02177:Ccdc81 APN 7 89875780 missense possibly damaging 0.94
IGL02396:Ccdc81 APN 7 89881649 missense probably benign
IGL02420:Ccdc81 APN 7 89875738 missense probably benign 0.16
IGL02536:Ccdc81 APN 7 89877580 splice site probably benign
IGL03195:Ccdc81 APN 7 89896708 missense probably benign 0.05
IGL03397:Ccdc81 APN 7 89896828 missense probably damaging 1.00
I0000:Ccdc81 UTSW 7 89898051 missense probably damaging 1.00
R0089:Ccdc81 UTSW 7 89893116 missense possibly damaging 0.87
R0409:Ccdc81 UTSW 7 89886215 missense probably benign 0.01
R0449:Ccdc81 UTSW 7 89890471 missense probably damaging 1.00
R0490:Ccdc81 UTSW 7 89887762 missense probably benign 0.28
R0511:Ccdc81 UTSW 7 89893296 missense probably damaging 1.00
R0562:Ccdc81 UTSW 7 89903229 missense probably benign 0.02
R0801:Ccdc81 UTSW 7 89887658 splice site probably null
R0944:Ccdc81 UTSW 7 89866569 missense probably damaging 0.99
R1006:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1334:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1526:Ccdc81 UTSW 7 89875873 missense probably damaging 0.99
R1623:Ccdc81 UTSW 7 89886182 missense probably benign 0.00
R1753:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1885:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1886:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1887:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1889:Ccdc81 UTSW 7 89882294 nonsense probably null
R1964:Ccdc81 UTSW 7 89886153 missense probably benign
R1997:Ccdc81 UTSW 7 89898063 missense probably damaging 1.00
R3725:Ccdc81 UTSW 7 89866630 missense possibly damaging 0.95
R5494:Ccdc81 UTSW 7 89877573 missense probably damaging 1.00
R5660:Ccdc81 UTSW 7 89893129 missense probably benign
R6434:Ccdc81 UTSW 7 89876144 missense probably damaging 1.00
R6711:Ccdc81 UTSW 7 89887798 missense probably damaging 0.98
R7287:Ccdc81 UTSW 7 89893123 missense probably damaging 0.98
R7582:Ccdc81 UTSW 7 89876145 missense probably damaging 0.99
R7914:Ccdc81 UTSW 7 89875780 missense possibly damaging 0.94
R7976:Ccdc81 UTSW 7 89866515 nonsense probably null
R7977:Ccdc81 UTSW 7 89876111 missense probably damaging 1.00
R7987:Ccdc81 UTSW 7 89876111 missense probably damaging 1.00
R7991:Ccdc81 UTSW 7 89890401 missense probably benign 0.01
R8002:Ccdc81 UTSW 7 89876135 missense probably benign
R8309:Ccdc81 UTSW 7 89877578 critical splice acceptor site probably null
RF018:Ccdc81 UTSW 7 89866698 splice site probably null
X0061:Ccdc81 UTSW 7 89877489 missense probably benign 0.00
Z1177:Ccdc81 UTSW 7 89881657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTCCAAAGACTGAATTTGTC -3'
(R):5'- CTCAGGCACATTACAAGTTCAC -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGATAGC -3'
(R):5'- AAGCTTGTCATCTCCAGG -3'
Posted On2018-03-15