Incidental Mutation 'R6275:Folr1'
ID507578
Institutional Source Beutler Lab
Gene Symbol Folr1
Ensembl Gene ENSMUSG00000001827
Gene Namefolate receptor 1 (adult)
SynonymsFolbp-1, folate receptor [a], Folbp1, folate-binding protein 1, FBP1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001252552.1, NM_008034.3, NM_001252553.1, NM_001252554.1; MGI:95568

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101858331-101870788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101859535 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 61 (N61I)
Ref Sequence ENSEMBL: ENSMUSP00000118547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106981] [ENSMUST00000106982] [ENSMUST00000106983] [ENSMUST00000106985] [ENSMUST00000106986] [ENSMUST00000123321] [ENSMUST00000123630] [ENSMUST00000124026] [ENSMUST00000126204] [ENSMUST00000134145] [ENSMUST00000140068] [ENSMUST00000151706] [ENSMUST00000209334] [ENSMUST00000210598] [ENSMUST00000150184] [ENSMUST00000140584] [ENSMUST00000155311]
Predicted Effect probably damaging
Transcript: ENSMUST00000106981
AA Change: N61I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102594
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106982
AA Change: N61I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102595
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106983
AA Change: N61I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102596
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 4.2e-68 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106985
AA Change: N61I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102598
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106986
AA Change: N61I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102599
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123321
SMART Domains Protein: ENSMUSP00000114167
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 6e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123630
SMART Domains Protein: ENSMUSP00000121947
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 4e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124026
Predicted Effect probably damaging
Transcript: ENSMUST00000126204
AA Change: N61I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117175
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 137 2.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134145
AA Change: N61I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118547
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 104 2.6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140068
AA Change: N61I

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114633
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 160 9.5e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151706
AA Change: N61I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115077
Gene: ENSMUSG00000001827
AA Change: N61I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 157 8.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect probably benign
Transcript: ENSMUST00000210598
Predicted Effect probably benign
Transcript: ENSMUST00000150184
Predicted Effect probably benign
Transcript: ENSMUST00000140584
Predicted Effect probably benign
Transcript: ENSMUST00000155311
SMART Domains Protein: ENSMUSP00000115360
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 53 3e-12 PDB
Meta Mutation Damage Score 0.7379 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype Strain: 2383986
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele are growth retarded and malformed, show multiple developmental anomalies, including neural and craniofacial defects, and die by E10. Folate supplementation of pregnant dams reduces embryonic mortality and improves many of the adverse developmental effects. [provided by MGI curators]
Allele List at MGI

All alleles(359) : Targeted(3) Gene trapped(356)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Folr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Folr1 APN 7 101858740 missense probably benign 0.00
IGL02423:Folr1 APN 7 101858525 missense probably benign 0.00
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R1022:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1024:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1562:Folr1 UTSW 7 101858594 missense probably damaging 0.98
R2299:Folr1 UTSW 7 101863992 missense probably damaging 1.00
R3690:Folr1 UTSW 7 101858538 missense probably benign 0.06
R4746:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R4747:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R5319:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R6243:Folr1 UTSW 7 101863965 missense probably damaging 1.00
R7284:Folr1 UTSW 7 101859470 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGCTGGATCCAGGGTCCC -3'
(R):5'- ACTCTATGAGGCTGCTCAGAAA -3'

Sequencing Primer
(F):5'- CCAAGTTCGGGGAACACTCATAG -3'
(R):5'- GAATTACAGACAGTTGTGAGCCTCC -3'
Posted On2018-03-15