Mutagenetix > Incidental Mutations

Incidental Mutation 'R6275:Abca7'

507585

Institutional Source

Beutler Lab

Gene Symbol

Abca7

Ensembl Gene

ENSMUSG00000035722

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 7

Synonyms

Abc51

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79996494-80015572 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79997791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 30 (L30H)

Ref Sequence

ENSEMBL: ENSMUSP00000128121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004784] [ENSMUST00000043866] [ENSMUST00000105374] [ENSMUST00000132517] [ENSMUST00000171637]

AlphaFold

Q91V24

Predicted Effect

probably benign
Transcript: ENSMUST00000004784

SMART Domains

Protein: ENSMUSP00000004784
Gene: ENSMUSG00000004665

Domain	Start	End	E-Value	Type
CH	30	127	1.82e-22	SMART
Pfam:Calponin	166	190	6e-20	PFAM
Pfam:Calponin	206	230	6e-20	PFAM
Pfam:Calponin	245	268	2.6e-10	PFAM
low complexity region	276	294	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000043866
AA Change: L30H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: L30H

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105374

SMART Domains

Protein: ENSMUSP00000101013
Gene: ENSMUSG00000004665

Domain	Start	End	E-Value	Type
CH	30	127	1.82e-22	SMART
Pfam:Calponin	130	152	7.6e-15	PFAM
Pfam:Calponin	167	192	4.1e-16	PFAM
Pfam:Calponin	206	230	6.4e-15	PFAM
low complexity region	237	255	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132517
AA Change: L30H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: L30H

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171637
AA Change: L30H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: L30H

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	517	747	2.8e-19	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1249	1271	N/A	INTRINSIC
low complexity region	1307	1317	N/A	INTRINSIC
low complexity region	1382	1398	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1426	1772	3.9e-47	PFAM
AAA	1841	2026	7.2e-9	SMART
low complexity region	2128	2143	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Itga10	A	G	3: 96,658,185	S1042G	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mov10l1	T	A	15: 89,026,620	I1071N	probably damaging	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stac3	T	A	10: 127,507,746	Y252*	probably null	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tanc1	A	T	2: 59,843,510	H1653L	probably benign	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tnr	A	C	1: 159,861,270	Q434P	probably damaging	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Usp42	G	A	5: 143,714,972	R1099W	probably damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Abca7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Abca7	APN	10	80011297	missense	probably damaging	0.96
IGL01074:Abca7	APN	10	80013892	missense	possibly damaging	0.88
IGL01313:Abca7	APN	10	80003123	splice site	probably benign
IGL01372:Abca7	APN	10	80006255	missense	probably benign	0.00
IGL01387:Abca7	APN	10	79999762	missense	possibly damaging	0.71
IGL01468:Abca7	APN	10	80003877	missense	probably benign	0.21
IGL01648:Abca7	APN	10	80011080	missense	probably damaging	1.00
IGL01796:Abca7	APN	10	80013909	missense	probably damaging	0.99
IGL01977:Abca7	APN	10	80006152	missense	probably benign	0.31
IGL01982:Abca7	APN	10	80002641	missense	probably damaging	1.00
IGL02115:Abca7	APN	10	79998079	missense	probably damaging	1.00
IGL02437:Abca7	APN	10	80008389	missense	probably damaging	1.00
IGL02721:Abca7	APN	10	80013635	missense	possibly damaging	0.93
IGL02812:Abca7	APN	10	80006047	missense	possibly damaging	0.84
IGL02823:Abca7	APN	10	80008822	missense	probably damaging	1.00
IGL02827:Abca7	APN	10	80009865	missense	probably damaging	1.00
IGL02897:Abca7	APN	10	80001592	missense	probably damaging	1.00
IGL02952:Abca7	APN	10	80007408	missense	probably damaging	1.00
R0507:Abca7	UTSW	10	80002821	splice site	probably benign
R0528:Abca7	UTSW	10	80003014	missense	probably damaging	1.00
R0541:Abca7	UTSW	10	80007351	missense	probably benign	0.01
R0584:Abca7	UTSW	10	80011730	missense	probably damaging	1.00
R1018:Abca7	UTSW	10	80001491	missense	probably damaging	1.00
R1099:Abca7	UTSW	10	80013743	nonsense	probably null
R1520:Abca7	UTSW	10	80008830	missense	possibly damaging	0.69
R1536:Abca7	UTSW	10	80014230	missense	probably benign	0.39
R1619:Abca7	UTSW	10	80009055	missense	probably damaging	1.00
R1636:Abca7	UTSW	10	80008998	missense	probably benign
R1752:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R1762:Abca7	UTSW	10	79999765	missense	probably damaging	1.00
R1764:Abca7	UTSW	10	80008950	missense	probably damaging	1.00
R1891:Abca7	UTSW	10	80005040	missense	possibly damaging	0.72
R1911:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R2032:Abca7	UTSW	10	80008237	missense	probably damaging	1.00
R2188:Abca7	UTSW	10	80002533	missense	probably damaging	1.00
R2973:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R2974:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R3055:Abca7	UTSW	10	79999747	missense	probably damaging	1.00
R4496:Abca7	UTSW	10	80002934	missense	probably damaging	1.00
R4570:Abca7	UTSW	10	80006694	missense	probably damaging	1.00
R4581:Abca7	UTSW	10	80006568	missense	probably benign	0.03
R4588:Abca7	UTSW	10	79997867	splice site	probably null
R4628:Abca7	UTSW	10	80015188	critical splice donor site	probably null
R4641:Abca7	UTSW	10	80005781	critical splice donor site	probably null
R4888:Abca7	UTSW	10	80002728	missense	probably damaging	0.97
R4911:Abca7	UTSW	10	80012188	critical splice donor site	probably null
R4979:Abca7	UTSW	10	80004783	nonsense	probably null
R4997:Abca7	UTSW	10	80007320	missense	possibly damaging	0.90
R5147:Abca7	UTSW	10	80015315	missense	probably benign	0.02
R5176:Abca7	UTSW	10	79998289	missense	probably benign	0.35
R5190:Abca7	UTSW	10	79999593	critical splice donor site	probably null
R5358:Abca7	UTSW	10	80013331	missense	probably damaging	0.99
R5409:Abca7	UTSW	10	80014320	missense	probably damaging	1.00
R5705:Abca7	UTSW	10	80015442	missense	probably benign
R6246:Abca7	UTSW	10	80015165	missense	probably damaging	1.00
R6256:Abca7	UTSW	10	80002622	missense	probably damaging	1.00
R6260:Abca7	UTSW	10	80008987	missense	probably damaging	1.00
R6277:Abca7	UTSW	10	80006158	missense	probably benign	0.04
R6284:Abca7	UTSW	10	80004410	missense	probably benign
R6307:Abca7	UTSW	10	80007387	missense	probably damaging	1.00
R6451:Abca7	UTSW	10	80006899	missense	probably damaging	0.99
R6456:Abca7	UTSW	10	80015150	missense	probably null	0.69
R6460:Abca7	UTSW	10	80009028	missense	probably benign	0.04
R6560:Abca7	UTSW	10	80007396	missense	probably damaging	1.00
R6565:Abca7	UTSW	10	80011788	missense	probably damaging	1.00
R6644:Abca7	UTSW	10	80008764	missense	probably damaging	0.98
R6814:Abca7	UTSW	10	80002999	missense	probably damaging	1.00
R7289:Abca7	UTSW	10	80009944	missense	probably damaging	1.00
R7303:Abca7	UTSW	10	80014988	missense	probably benign	0.17
R7493:Abca7	UTSW	10	80002062	missense	probably damaging	0.96
R7535:Abca7	UTSW	10	80001629	missense	probably benign	0.04
R7602:Abca7	UTSW	10	79998012	critical splice acceptor site	probably null
R7607:Abca7	UTSW	10	80011833	missense	probably damaging	1.00
R7647:Abca7	UTSW	10	80000822	missense	probably benign	0.00
R7821:Abca7	UTSW	10	80002590	small deletion	probably benign
R7863:Abca7	UTSW	10	80008821	missense	probably damaging	1.00
R7896:Abca7	UTSW	10	80004958	missense	probably damaging	1.00
R7911:Abca7	UTSW	10	80005033	missense	probably benign	0.00
R8114:Abca7	UTSW	10	80009040	missense	probably damaging	1.00
R8356:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8439:Abca7	UTSW	10	80006161	missense	probably benign	0.03
R8456:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8830:Abca7	UTSW	10	80008971	missense	probably damaging	1.00
R9004:Abca7	UTSW	10	80005649	missense	probably damaging	1.00
R9066:Abca7	UTSW	10	80013354	missense	probably damaging	0.98
R9116:Abca7	UTSW	10	80003139	missense
R9128:Abca7	UTSW	10	80002518	missense	possibly damaging	0.95
R9141:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
R9184:Abca7	UTSW	10	80002856	missense	probably damaging	0.97
R9246:Abca7	UTSW	10	80002701	missense	probably damaging	1.00
R9320:Abca7	UTSW	10	79997637	missense	possibly damaging	0.55
R9426:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
Z1176:Abca7	UTSW	10	79999432	nonsense	probably null
Z1176:Abca7	UTSW	10	80006559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGAGTCATCATGGCCTTAG -3'
(R):5'- GGAGACATCTGCTCATAGTCG -3'

Sequencing Primer
(F):5'- TTAGGCACACAGCTGATGC -3'
(R):5'- GACATCTGCTCATAGTCGCCCTC -3'

Posted On

2018-03-15