Incidental Mutation 'R6275:4932415D10Rik'
ID 507586
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene Name RIKEN cDNA 4932415D10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R6275 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 82282116-82316582 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82285368 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3936 (D3936G)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171401] [ENSMUST00000217661]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000171401
SMART Domains Protein: ENSMUSP00000126178
Gene: ENSMUSG00000044581

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 241 263 N/A INTRINSIC
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217661
AA Change: D3936G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
R7875:4932415D10Rik UTSW 10 82287622 missense possibly damaging 0.79
R7878:4932415D10Rik UTSW 10 82284022 missense probably benign 0.04
R7899:4932415D10Rik UTSW 10 82282897 missense unknown
R7905:4932415D10Rik UTSW 10 82296102 missense probably benign 0.03
R7975:4932415D10Rik UTSW 10 82283989 missense possibly damaging 0.95
R7988:4932415D10Rik UTSW 10 82296100 missense probably benign 0.03
R8076:4932415D10Rik UTSW 10 82296686 nonsense probably null
R8144:4932415D10Rik UTSW 10 82294599 nonsense probably null
R8429:4932415D10Rik UTSW 10 82289467 missense possibly damaging 0.62
R8465:4932415D10Rik UTSW 10 82316464 missense possibly damaging 0.52
R8470:4932415D10Rik UTSW 10 82290480 missense probably damaging 1.00
R8509:4932415D10Rik UTSW 10 82291116 missense probably benign 0.01
R8515:4932415D10Rik UTSW 10 82288602 missense probably benign 0.00
R8672:4932415D10Rik UTSW 10 82291892 missense probably benign 0.01
R8700:4932415D10Rik UTSW 10 82292025 missense possibly damaging 0.84
R8827:4932415D10Rik UTSW 10 82293783 missense probably benign 0.07
R8872:4932415D10Rik UTSW 10 82292785 missense probably benign 0.07
R8875:4932415D10Rik UTSW 10 82287642 missense probably benign 0.16
R8884:4932415D10Rik UTSW 10 82283652 missense probably damaging 0.96
R8906:4932415D10Rik UTSW 10 82286545 missense probably benign 0.02
R8924:4932415D10Rik UTSW 10 82295461 missense probably benign 0.03
R8949:4932415D10Rik UTSW 10 82287919 missense probably benign 0.00
R8957:4932415D10Rik UTSW 10 82289074 missense probably benign 0.07
R9042:4932415D10Rik UTSW 10 82287351 missense probably benign 0.08
R9056:4932415D10Rik UTSW 10 82291267 missense probably benign 0.01
R9062:4932415D10Rik UTSW 10 82291111 missense probably benign 0.03
R9074:4932415D10Rik UTSW 10 82288060 missense possibly damaging 0.90
R9076:4932415D10Rik UTSW 10 82288556 small deletion probably benign
R9086:4932415D10Rik UTSW 10 82288743 missense probably benign 0.07
R9113:4932415D10Rik UTSW 10 82295518 nonsense probably null
R9119:4932415D10Rik UTSW 10 82295719 missense probably benign 0.03
R9132:4932415D10Rik UTSW 10 82292062 missense possibly damaging 0.85
R9141:4932415D10Rik UTSW 10 82290776 missense probably damaging 0.98
R9151:4932415D10Rik UTSW 10 82285094 missense probably damaging 0.99
R9155:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R9159:4932415D10Rik UTSW 10 82282690 nonsense probably null
R9197:4932415D10Rik UTSW 10 82284567 missense possibly damaging 0.88
R9212:4932415D10Rik UTSW 10 82283145 missense possibly damaging 0.88
R9245:4932415D10Rik UTSW 10 82287720 missense probably benign 0.10
R9304:4932415D10Rik UTSW 10 82296096 missense probably benign 0.07
R9309:4932415D10Rik UTSW 10 82295152 missense probably benign 0.00
R9329:4932415D10Rik UTSW 10 82285605 missense probably benign 0.06
R9356:4932415D10Rik UTSW 10 82289323 missense possibly damaging 0.54
R9423:4932415D10Rik UTSW 10 82287625 missense possibly damaging 0.62
R9426:4932415D10Rik UTSW 10 82290776 missense probably damaging 0.98
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Z1176:4932415D10Rik UTSW 10 82282537 missense unknown
Z1176:4932415D10Rik UTSW 10 82289896 missense possibly damaging 0.94
Z1176:4932415D10Rik UTSW 10 82293228 missense probably benign 0.03
Z1177:4932415D10Rik UTSW 10 82285798 missense possibly damaging 0.46
Z1177:4932415D10Rik UTSW 10 82287126 missense possibly damaging 0.85
Z1177:4932415D10Rik UTSW 10 82287417 missense probably damaging 0.99
Z1177:4932415D10Rik UTSW 10 82289686 nonsense probably null
Z1187:4932415D10Rik UTSW 10 82288556 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTTCTTCGAGCCCCTAATC -3'
(R):5'- AAGACTCAGAGGTGACCACATC -3'

Sequencing Primer
(F):5'- CCTGTAACTCCTCTGATAGTAGTTTG -3'
(R):5'- GTGACCACATCAGCAAAATTACAGG -3'
Posted On 2018-03-15