Incidental Mutation 'R6275:Slc26a11'
ID507593
Institutional Source Beutler Lab
Gene Symbol Slc26a11
Ensembl Gene ENSMUSG00000039908
Gene Namesolute carrier family 26, member 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119355557-119381079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119359299 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 127 (F127L)
Ref Sequence ENSEMBL: ENSMUSP00000050999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000050880] [ENSMUST00000100172] [ENSMUST00000136523]
Predicted Effect probably benign
Transcript: ENSMUST00000005173
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050880
AA Change: F127L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908
AA Change: F127L

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100172
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133507
Predicted Effect probably benign
Transcript: ENSMUST00000136523
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151612
Meta Mutation Damage Score 0.1926 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute linked carrier 26 family of anion exchangers. Members of this family of proteins are essential for numerous cellular functions including homeostasis and intracellular electrolyte balance. The encoded protein is a sodium independent sulfate transporter that is sensitive to the anion exchanger inhibitor 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Slc26a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Slc26a11 APN 11 119379901 missense probably benign 0.00
IGL01359:Slc26a11 APN 11 119363431 missense probably benign 0.00
IGL01835:Slc26a11 APN 11 119377214 missense probably benign
R0193:Slc26a11 UTSW 11 119359314 missense probably damaging 1.00
R0362:Slc26a11 UTSW 11 119379941 splice site probably benign
R0709:Slc26a11 UTSW 11 119374777 missense probably damaging 1.00
R1800:Slc26a11 UTSW 11 119373153 missense probably damaging 0.97
R1964:Slc26a11 UTSW 11 119380194 missense possibly damaging 0.93
R4762:Slc26a11 UTSW 11 119356831 unclassified probably benign
R5153:Slc26a11 UTSW 11 119377259 missense possibly damaging 0.67
R5302:Slc26a11 UTSW 11 119363450 missense probably damaging 0.99
R5660:Slc26a11 UTSW 11 119357978 missense probably damaging 0.98
R5994:Slc26a11 UTSW 11 119379912 missense probably benign 0.14
R6025:Slc26a11 UTSW 11 119374828 missense probably damaging 1.00
R6970:Slc26a11 UTSW 11 119356972 missense probably damaging 1.00
R6974:Slc26a11 UTSW 11 119358018 missense possibly damaging 0.82
R7466:Slc26a11 UTSW 11 119374502 missense probably damaging 0.99
R8210:Slc26a11 UTSW 11 119379866 missense possibly damaging 0.84
R8459:Slc26a11 UTSW 11 119368817 missense possibly damaging 0.88
X0026:Slc26a11 UTSW 11 119380230 missense probably benign
X0028:Slc26a11 UTSW 11 119380194 missense possibly damaging 0.93
Z1177:Slc26a11 UTSW 11 119356959 missense not run
Predicted Primers PCR Primer
(F):5'- AAACTCACATAGGCACGCGG -3'
(R):5'- GGAATGTGCTTCTTGGTCCACAG -3'

Sequencing Primer
(F):5'- TAGGCACGCGGGCACAC -3'
(R):5'- TCTTGGTCCACAGTGAACAG -3'
Posted On2018-03-15