Incidental Mutation 'R6275:Rbm25'
ID507595
Institutional Source Beutler Lab
Gene Symbol Rbm25
Ensembl Gene ENSMUSG00000010608
Gene NameRNA binding motif protein 25
SynonymsA130095G20Rik, 2610015J01Rik, 2600011C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83631236-83683123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83644432 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 66 (M66K)
Ref Sequence ENSEMBL: ENSMUSP00000138665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048155] [ENSMUST00000181983] [ENSMUST00000182004] [ENSMUST00000182036] [ENSMUST00000182347] [ENSMUST00000182450] [ENSMUST00000182618] [ENSMUST00000182633] [ENSMUST00000183154]
Predicted Effect unknown
Transcript: ENSMUST00000048155
AA Change: M47K
SMART Domains Protein: ENSMUSP00000048470
Gene: ENSMUSG00000010608
AA Change: M47K

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
low complexity region 234 241 N/A INTRINSIC
coiled coil region 270 351 N/A INTRINSIC
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 606 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
PWI 758 831 2.79e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000181983
AA Change: M47K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138572
Gene: ENSMUSG00000010608
AA Change: M47K

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
internal_repeat_1 187 203 3e-5 PROSPERO
low complexity region 234 241 N/A INTRINSIC
internal_repeat_1 258 274 3e-5 PROSPERO
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
low complexity region 575 584 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182004
AA Change: M47K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138573
Gene: ENSMUSG00000010608
AA Change: M47K

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182032
Predicted Effect possibly damaging
Transcript: ENSMUST00000182036
AA Change: M47K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138565
Gene: ENSMUSG00000010608
AA Change: M47K

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182255
Predicted Effect probably benign
Transcript: ENSMUST00000182347
Predicted Effect probably benign
Transcript: ENSMUST00000182450
AA Change: M47K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138416
Gene: ENSMUSG00000010608
AA Change: M47K

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182618
AA Change: M66K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138665
Gene: ENSMUSG00000010608
AA Change: M66K

DomainStartEndE-ValueType
low complexity region 29 63 N/A INTRINSIC
RRM 107 172 3.44e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182633
AA Change: M66K

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138625
Gene: ENSMUSG00000010608
AA Change: M66K

DomainStartEndE-ValueType
low complexity region 29 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183128
Predicted Effect possibly damaging
Transcript: ENSMUST00000183154
AA Change: M66K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138669
Gene: ENSMUSG00000010608
AA Change: M66K

DomainStartEndE-ValueType
low complexity region 29 63 N/A INTRINSIC
Meta Mutation Damage Score 0.8555 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Rbm25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Rbm25 APN 12 83659567 missense probably damaging 1.00
IGL02095:Rbm25 APN 12 83671974 missense probably damaging 1.00
IGL02227:Rbm25 APN 12 83672753 missense probably damaging 1.00
IGL02454:Rbm25 APN 12 83660322 missense probably benign 0.02
IGL02704:Rbm25 APN 12 83642726 missense probably damaging 1.00
IGL02726:Rbm25 APN 12 83672852 missense probably damaging 1.00
IGL03384:Rbm25 APN 12 83659523 missense probably benign 0.28
R0380:Rbm25 UTSW 12 83660356 missense probably benign 0.02
R0829:Rbm25 UTSW 12 83660376 splice site probably benign
R1330:Rbm25 UTSW 12 83677892 missense probably damaging 1.00
R1346:Rbm25 UTSW 12 83644393 splice site probably benign
R1518:Rbm25 UTSW 12 83668445 missense possibly damaging 0.91
R1566:Rbm25 UTSW 12 83675054 missense probably damaging 0.98
R1660:Rbm25 UTSW 12 83668150 unclassified probably benign
R1809:Rbm25 UTSW 12 83672727 splice site probably benign
R2213:Rbm25 UTSW 12 83676082 missense probably benign 0.00
R2336:Rbm25 UTSW 12 83651418 missense probably damaging 1.00
R2943:Rbm25 UTSW 12 83660641 missense probably damaging 1.00
R3971:Rbm25 UTSW 12 83675208 missense probably benign 0.03
R4349:Rbm25 UTSW 12 83675173 missense probably damaging 0.99
R4740:Rbm25 UTSW 12 83644407 missense possibly damaging 0.61
R4987:Rbm25 UTSW 12 83677856 missense probably damaging 1.00
R5205:Rbm25 UTSW 12 83672869 missense probably benign 0.03
R5579:Rbm25 UTSW 12 83668507 missense probably benign 0.41
R5603:Rbm25 UTSW 12 83664216 nonsense probably null
R5909:Rbm25 UTSW 12 83681588 missense probably damaging 0.97
R5930:Rbm25 UTSW 12 83677866 missense possibly damaging 0.46
R5982:Rbm25 UTSW 12 83671951 missense probably damaging 0.99
R6233:Rbm25 UTSW 12 83659426 missense probably benign 0.24
R6282:Rbm25 UTSW 12 83676089 missense probably damaging 0.98
R7156:Rbm25 UTSW 12 83664191 missense unknown
R7188:Rbm25 UTSW 12 83663998 missense unknown
R7217:Rbm25 UTSW 12 83664217 missense unknown
R7403:Rbm25 UTSW 12 83676134 missense probably damaging 1.00
R7508:Rbm25 UTSW 12 83672877 missense probably damaging 0.99
R7703:Rbm25 UTSW 12 83675090 missense possibly damaging 0.69
R8004:Rbm25 UTSW 12 83674392 missense possibly damaging 0.61
R8154:Rbm25 UTSW 12 83644431 missense unknown
R8444:Rbm25 UTSW 12 83664251 missense unknown
Z1176:Rbm25 UTSW 12 83672884 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCCTATGCCTTACTTTCATGTGG -3'
(R):5'- GGCATTTCCTAAATCTTAATCTTCCC -3'

Sequencing Primer
(F):5'- ATGTGGATGCTCATCACTATCCTGTG -3'
(R):5'- AGCTAGCTAAGGAGACTCTTGTCC -3'
Posted On2018-03-15