Incidental Mutation 'R6275:Cyp2d12'
ID507601
Institutional Source Beutler Lab
Gene Symbol Cyp2d12
Ensembl Gene ENSMUSG00000096852
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82555072-82560403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82556658 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 126 (P126T)
Ref Sequence ENSEMBL: ENSMUSP00000071064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068861] [ENSMUST00000228974] [ENSMUST00000229103] [ENSMUST00000229904]
Predicted Effect probably benign
Transcript: ENSMUST00000068861
AA Change: P126T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071064
Gene: ENSMUSG00000096852
AA Change: P126T

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 37 497 3.6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184191
Predicted Effect probably benign
Transcript: ENSMUST00000228974
Predicted Effect probably benign
Transcript: ENSMUST00000229103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229792
Predicted Effect probably benign
Transcript: ENSMUST00000229904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Cyp2d12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Cyp2d12 APN 15 82555344 splice site probably benign
IGL02318:Cyp2d12 APN 15 82555243 missense probably benign 0.33
IGL02353:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02360:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02491:Cyp2d12 APN 15 82558481 missense possibly damaging 0.88
IGL02651:Cyp2d12 APN 15 82556740 missense probably damaging 0.99
IGL02664:Cyp2d12 APN 15 82559334 missense probably benign
IGL03169:Cyp2d12 APN 15 82559291 missense probably benign 0.00
IGL03354:Cyp2d12 APN 15 82558961 missense probably damaging 1.00
PIT4581001:Cyp2d12 UTSW 15 82558451 missense probably damaging 1.00
R0426:Cyp2d12 UTSW 15 82558963 missense probably benign 0.12
R0578:Cyp2d12 UTSW 15 82556383 splice site probably benign
R1297:Cyp2d12 UTSW 15 82557686 missense probably benign 0.31
R1517:Cyp2d12 UTSW 15 82558136 missense probably damaging 1.00
R1718:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R1829:Cyp2d12 UTSW 15 82558056 missense possibly damaging 0.87
R2208:Cyp2d12 UTSW 15 82556936 missense probably damaging 1.00
R2366:Cyp2d12 UTSW 15 82555154 missense probably damaging 1.00
R2385:Cyp2d12 UTSW 15 82558495 missense probably benign 0.00
R2504:Cyp2d12 UTSW 15 82559036 missense probably benign 0.06
R4009:Cyp2d12 UTSW 15 82556292 missense probably damaging 1.00
R4940:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R5237:Cyp2d12 UTSW 15 82558006 splice site probably null
R5327:Cyp2d12 UTSW 15 82555222 missense probably benign 0.00
R5549:Cyp2d12 UTSW 15 82556297 missense probably benign 0.23
R6128:Cyp2d12 UTSW 15 82558965 missense probably benign
R6723:Cyp2d12 UTSW 15 82556884 missense probably benign
R6808:Cyp2d12 UTSW 15 82556733 missense probably damaging 1.00
R6947:Cyp2d12 UTSW 15 82559047 missense probably benign
R7137:Cyp2d12 UTSW 15 82557821 missense probably benign 0.42
R7224:Cyp2d12 UTSW 15 82557648 splice site probably null
R7513:Cyp2d12 UTSW 15 82558420 missense probably benign
R7698:Cyp2d12 UTSW 15 82558970 missense probably benign 0.02
R7753:Cyp2d12 UTSW 15 82556963 missense possibly damaging 0.68
X0065:Cyp2d12 UTSW 15 82557828 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGTCAAGCAATTCACAGCAG -3'
(R):5'- CCTGGAAGTGGAGATTCAAGC -3'

Sequencing Primer
(F):5'- GTCAAGCAATTCACAGCAGAGTCAC -3'
(R):5'- GGACTGCCCATGTATCCCTGTG -3'
Posted On2018-03-15