Incidental Mutation 'R6275:Zfp994'
ID 507606
Institutional Source Beutler Lab
Gene Symbol Zfp994
Ensembl Gene ENSMUSG00000096433
Gene Name zinc finger protein 994
Synonyms Gm4944
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R6275 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 22197265-22225614 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 22199991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 659 (L659*)
Ref Sequence ENSEMBL: ENSMUSP00000136105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179996]
AlphaFold J3QM38
Predicted Effect probably null
Transcript: ENSMUST00000179996
AA Change: L659*
SMART Domains Protein: ENSMUSP00000136105
Gene: ENSMUSG00000096433
AA Change: L659*

DomainStartEndE-ValueType
KRAB 13 73 3.33e-20 SMART
ZnF_C2H2 183 205 8.09e-1 SMART
ZnF_C2H2 211 233 1.84e-4 SMART
ZnF_C2H2 239 261 2.99e-4 SMART
ZnF_C2H2 267 289 1.04e-3 SMART
ZnF_C2H2 295 317 2.61e-4 SMART
ZnF_C2H2 323 345 4.3e-5 SMART
ZnF_C2H2 351 373 6.78e-3 SMART
ZnF_C2H2 379 401 1.12e-3 SMART
ZnF_C2H2 407 429 5.5e-3 SMART
ZnF_C2H2 435 457 1.3e-4 SMART
ZnF_C2H2 463 485 1.67e-2 SMART
ZnF_C2H2 491 513 1.47e-3 SMART
ZnF_C2H2 519 541 2.4e-3 SMART
ZnF_C2H2 547 569 7.67e-2 SMART
ZnF_C2H2 575 597 8.6e-5 SMART
ZnF_C2H2 603 625 8.02e-5 SMART
ZnF_C2H2 631 653 9.22e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Other mutations in Zfp994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Zfp994 APN 17 22202680 missense probably damaging 0.98
dreamer UTSW 17 22205325 missense probably damaging 1.00
fanciful UTSW 17 22201100 missense probably damaging 1.00
R0361:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R0498:Zfp994 UTSW 17 22200901 missense probably damaging 0.99
R0567:Zfp994 UTSW 17 22200468 missense possibly damaging 0.82
R1075:Zfp994 UTSW 17 22200945 missense probably damaging 1.00
R1561:Zfp994 UTSW 17 22201225 missense probably damaging 1.00
R2117:Zfp994 UTSW 17 22200981 missense probably damaging 1.00
R2313:Zfp994 UTSW 17 22201285 missense probably damaging 1.00
R4486:Zfp994 UTSW 17 22201560 missense probably damaging 1.00
R4906:Zfp994 UTSW 17 22200467 nonsense probably null
R4924:Zfp994 UTSW 17 22200757 missense probably damaging 0.98
R5394:Zfp994 UTSW 17 22200525 missense probably damaging 1.00
R5560:Zfp994 UTSW 17 22201713 missense possibly damaging 0.62
R5746:Zfp994 UTSW 17 22201273 missense probably damaging 0.99
R6459:Zfp994 UTSW 17 22200546 missense possibly damaging 0.83
R6668:Zfp994 UTSW 17 22201100 missense probably damaging 1.00
R7343:Zfp994 UTSW 17 22200068 missense probably benign 0.12
R7625:Zfp994 UTSW 17 22201755 missense possibly damaging 0.85
R7709:Zfp994 UTSW 17 22200425 missense probably benign 0.00
R7725:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R7756:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R7758:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R7959:Zfp994 UTSW 17 22202780 missense probably damaging 0.99
R8033:Zfp994 UTSW 17 22200684 missense probably damaging 1.00
R8199:Zfp994 UTSW 17 22200223 nonsense probably null
R8365:Zfp994 UTSW 17 22201246 missense probably damaging 1.00
R8770:Zfp994 UTSW 17 22200999 missense probably damaging 1.00
R8893:Zfp994 UTSW 17 22205325 missense probably damaging 1.00
R9130:Zfp994 UTSW 17 22200000 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGAGATTTGGGTAAAGACCTTTCC -3'
(R):5'- TCATCAGAGAATTCATACAGGAGAG -3'

Sequencing Primer
(F):5'- AAGGTGTCTACTGTATGCATTCTC -3'
(R):5'- GAATTCATACAGGAGAGAAACCTTAC -3'
Posted On 2018-03-15