Incidental Mutation 'R6275:Sf3b2'
ID507611
Institutional Source Beutler Lab
Gene Symbol Sf3b2
Ensembl Gene ENSMUSG00000024853
Gene Namesplicing factor 3b, subunit 2
Synonyms145kDa, 2610311M13Rik, 2810441F20Rik, SF3b150, SF3b145, B230398H18Rik, SAP145, SF3b1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5273923-5295455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 5283650 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 640 (I640S)
Ref Sequence ENSEMBL: ENSMUSP00000025774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025774]
Predicted Effect probably damaging
Transcript: ENSMUST00000025774
AA Change: I640S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025774
Gene: ENSMUSG00000024853
AA Change: I640S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
SAP 24 58 1.84e-4 SMART
low complexity region 91 132 N/A INTRINSIC
coiled coil region 140 178 N/A INTRINSIC
low complexity region 201 221 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
low complexity region 408 437 N/A INTRINSIC
Pfam:DUF382 453 579 2.9e-63 PFAM
PSP 584 642 9.41e-33 SMART
low complexity region 693 717 N/A INTRINSIC
low complexity region 745 756 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Sf3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sf3b2 APN 19 5279587 missense probably benign 0.00
IGL01737:Sf3b2 APN 19 5279838 splice site probably benign
IGL02205:Sf3b2 APN 19 5283737 missense probably benign 0.01
R0184:Sf3b2 UTSW 19 5283672 missense probably damaging 1.00
R0370:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0371:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0372:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0373:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0375:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R1606:Sf3b2 UTSW 19 5287998 missense probably benign 0.00
R1609:Sf3b2 UTSW 19 5295033 unclassified probably benign
R2566:Sf3b2 UTSW 19 5275090 missense possibly damaging 0.92
R5163:Sf3b2 UTSW 19 5275137 missense probably damaging 1.00
R6208:Sf3b2 UTSW 19 5275098 missense possibly damaging 0.82
R6644:Sf3b2 UTSW 19 5279964 splice site probably null
R6986:Sf3b2 UTSW 19 5279895 missense probably benign
R7007:Sf3b2 UTSW 19 5274517 missense probably benign 0.13
R8428:Sf3b2 UTSW 19 5287214 missense possibly damaging 0.52
Z1177:Sf3b2 UTSW 19 5274950 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTGTGCATGCAACAGAAAG -3'
(R):5'- CTGAGTGCTTGGGAAAGCTG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAAGCCG -3'
(R):5'- TGCTTGGGAAAGCTGGAGAG -3'
Posted On2018-03-15