Incidental Mutation 'R6275:Hps1'
ID507612
Institutional Source Beutler Lab
Gene Symbol Hps1
Ensembl Gene ENSMUSG00000025188
Gene NameHPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms6030422N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42755105-42779978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42769607 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 169 (E169G)
Ref Sequence ENSEMBL: ENSMUSP00000124209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026194] [ENSMUST00000069298] [ENSMUST00000160455] [ENSMUST00000162004] [ENSMUST00000162061]
Predicted Effect probably null
Transcript: ENSMUST00000026194
AA Change: E169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026194
Gene: ENSMUSG00000025188
AA Change: E169G

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069298
AA Change: E169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071069
Gene: ENSMUSG00000025188
AA Change: E169G

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159974
Predicted Effect probably null
Transcript: ENSMUST00000160455
AA Change: E169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125662
Gene: ENSMUSG00000025188
AA Change: E169G

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161761
Predicted Effect probably null
Transcript: ENSMUST00000162004
AA Change: E169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125226
Gene: ENSMUSG00000025188
AA Change: E169G

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162061
AA Change: E169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124209
Gene: ENSMUSG00000025188
AA Change: E169G

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Meta Mutation Damage Score 0.7001 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is a component of three different protein complexes termed biogenesis of lysosome-related organelles complex (BLOC)-3, BLOC4, and BLOC5. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 1. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on chromosome 22. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit hypopigmentation and increased bleeding time. Impaired natural killer cell function, reduced secretion of kidney lysosomal enzymes,and abnormal retinofugal neuronal projections characterize some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Hps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hps1 APN 19 42771129 nonsense probably null
IGL02327:Hps1 APN 19 42756345 unclassified probably benign
IGL02488:Hps1 APN 19 42757788 unclassified probably benign
IGL03161:Hps1 APN 19 42767271 missense probably damaging 1.00
R0127:Hps1 UTSW 19 42771111 splice site probably benign
R0134:Hps1 UTSW 19 42766180 missense probably damaging 0.98
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0394:Hps1 UTSW 19 42770899 splice site probably null
R1435:Hps1 UTSW 19 42762275 missense probably benign 0.04
R1537:Hps1 UTSW 19 42759704 critical splice donor site probably null
R1616:Hps1 UTSW 19 42767185 missense probably damaging 1.00
R1860:Hps1 UTSW 19 42762449 missense probably damaging 1.00
R2014:Hps1 UTSW 19 42762512 missense probably benign 0.00
R3424:Hps1 UTSW 19 42760513 missense possibly damaging 0.75
R4472:Hps1 UTSW 19 42762496 missense probably damaging 1.00
R5476:Hps1 UTSW 19 42769602 splice site probably null
R6054:Hps1 UTSW 19 42770778 missense probably damaging 0.96
R6807:Hps1 UTSW 19 42770778 missense possibly damaging 0.60
R6916:Hps1 UTSW 19 42766725
R7332:Hps1 UTSW 19 42777912 splice site probably null
R7487:Hps1 UTSW 19 42756261 missense probably damaging 1.00
R7504:Hps1 UTSW 19 42766720 missense probably benign 0.00
R7823:Hps1 UTSW 19 42755707 missense possibly damaging 0.58
R7955:Hps1 UTSW 19 42770782 missense probably damaging 0.99
R8198:Hps1 UTSW 19 42767220 missense probably benign 0.05
Z1176:Hps1 UTSW 19 42766686 missense probably null 0.00
Z1177:Hps1 UTSW 19 42755696 missense probably benign 0.00
Z1177:Hps1 UTSW 19 42759831 missense probably damaging 1.00
Z1177:Hps1 UTSW 19 42766218 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAACTCTCACCCGGAATTCAG -3'
(R):5'- GACAGGAACCTTGGATTGGG -3'

Sequencing Primer
(F):5'- GGAATTCAGTTGCTCACCATGGAAC -3'
(R):5'- GGCCGGACAAGACCAACTTTC -3'
Posted On2018-03-15