Mutagenetix > Incidental Mutations

Incidental Mutation 'R6276:Actr3'

507615

Institutional Source

Beutler Lab

Gene Symbol

Actr3

Ensembl Gene

ENSMUSG00000026341

Gene Name

ARP3 actin-related protein 3

Synonyms

1200003A09Rik, Arp3

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_023735.2, NM_001205385.1, NM_001205386.1; MGI: 1921367

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125392905-125435727 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 125395137 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 364 (D364E)

Ref Sequence

ENSEMBL: ENSMUSP00000137503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027579] [ENSMUST00000178474] [ENSMUST00000191578]

Predicted Effect

probably benign
Transcript: ENSMUST00000027579
AA Change: D364E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027579
Gene: ENSMUSG00000026341
AA Change: D364E

Domain	Start	End	E-Value	Type
ACTIN	5	413	1.62e-186	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000178474
AA Change: D364E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000137503
Gene: ENSMUSG00000026341
AA Change: D364E

Domain	Start	End	E-Value	Type
ACTIN	5	413	1.62e-186	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186008

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188362

Predicted Effect

probably benign
Transcript: ENSMUST00000191578

Meta Mutation Damage Score

0.0583

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

Strain: 3765916
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele die prior to E4.5 and exhibit abnormal embryogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Arhgap45	A	T	10: 80,026,234	S541C	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
Cntnap4	A	T	8: 112,752,289	T216S	possibly damaging	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Galnt7	C	T	8: 57,536,578		probably null	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lrrk1	A	G	7: 66,306,839		probably null	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Rspry1	T	A	8: 94,623,258	H91Q	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Tex15	T	A	8: 33,577,189	F2216I	possibly damaging	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Actr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Actr3	APN	1	125397229	missense	probably benign	0.00
IGL00574:Actr3	APN	1	125411274	missense	probably damaging	1.00
IGL00715:Actr3	APN	1	125395076	missense	probably damaging	0.96
IGL01139:Actr3	APN	1	125405885	missense	probably damaging	1.00
IGL01897:Actr3	APN	1	125418288	missense	possibly damaging	0.54
P0023:Actr3	UTSW	1	125395066	critical splice donor site	probably null
R0217:Actr3	UTSW	1	125407413	splice site	probably benign
R0660:Actr3	UTSW	1	125408567	missense	probably benign	0.40
R1494:Actr3	UTSW	1	125416281	missense	probably benign	0.06
R1582:Actr3	UTSW	1	125405925	missense	probably benign	0.01
R1589:Actr3	UTSW	1	125408563	missense	probably damaging	1.00
R3432:Actr3	UTSW	1	125394039	missense	probably damaging	1.00
R5810:Actr3	UTSW	1	125416379	intron	probably benign
R6089:Actr3	UTSW	1	125407395	missense	probably damaging	1.00
R7120:Actr3	UTSW	1	125403432	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTCTGGTGAATACTGTTTCTACAC -3'
(R):5'- AGTGTGGTCATCTTCATCTGC -3'

Sequencing Primer
(F):5'- AGTAAGGACAAGGTAAAAAGAACAAC -3'
(R):5'- GCTGTTCCATCACACCCACTCTAG -3'

Posted On

2018-03-15