Incidental Mutation 'R6276:Actr3'
ID 507615
Institutional Source Beutler Lab
Gene Symbol Actr3
Ensembl Gene ENSMUSG00000026341
Gene Name ARP3 actin-related protein 3
Synonyms 1200003A09Rik, Arp3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_023735.2, NM_001205385.1, NM_001205386.1; MGI: 1921367
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6276 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 125392905-125435727 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125395137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 364 (D364E)
Ref Sequence ENSEMBL: ENSMUSP00000137503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027579] [ENSMUST00000178474] [ENSMUST00000191578]
AlphaFold Q99JY9
Predicted Effect probably benign
Transcript: ENSMUST00000027579
AA Change: D364E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027579
Gene: ENSMUSG00000026341
AA Change: D364E

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178474
AA Change: D364E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137503
Gene: ENSMUSG00000026341
AA Change: D364E

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188362
Predicted Effect probably benign
Transcript: ENSMUST00000191578
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 3765916
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele die prior to E4.5 and exhibit abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(12)
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Actr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Actr3 APN 1 125397229 missense probably benign 0.00
IGL00574:Actr3 APN 1 125411274 missense probably damaging 1.00
IGL00715:Actr3 APN 1 125395076 missense probably damaging 0.96
IGL01139:Actr3 APN 1 125405885 missense probably damaging 1.00
IGL01897:Actr3 APN 1 125418288 missense possibly damaging 0.54
P0023:Actr3 UTSW 1 125395066 critical splice donor site probably null
R0217:Actr3 UTSW 1 125407413 splice site probably benign
R0660:Actr3 UTSW 1 125408567 missense probably benign 0.40
R1494:Actr3 UTSW 1 125416281 missense probably benign 0.06
R1582:Actr3 UTSW 1 125405925 missense probably benign 0.01
R1589:Actr3 UTSW 1 125408563 missense probably damaging 1.00
R3432:Actr3 UTSW 1 125394039 missense probably damaging 1.00
R5810:Actr3 UTSW 1 125416379 intron probably benign
R6089:Actr3 UTSW 1 125407395 missense probably damaging 1.00
R7120:Actr3 UTSW 1 125403432 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTGGTGAATACTGTTTCTACAC -3'
(R):5'- AGTGTGGTCATCTTCATCTGC -3'

Sequencing Primer
(F):5'- AGTAAGGACAAGGTAAAAAGAACAAC -3'
(R):5'- GCTGTTCCATCACACCCACTCTAG -3'
Posted On 2018-03-15