Incidental Mutation 'R6276:Phactr3'
ID507623
Institutional Source Beutler Lab
Gene Symbol Phactr3
Ensembl Gene ENSMUSG00000027525
Gene Namephosphatase and actin regulator 3
Synonyms4930415A02Rik, 1500003N10Rik, scapinin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6276 (G1)
Quality Score197.009
Status Validated
Chromosome2
Chromosomal Location178118975-178338492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 178279019 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 222 (E222K)
Ref Sequence ENSEMBL: ENSMUSP00000104543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103065] [ENSMUST00000103066] [ENSMUST00000108915] [ENSMUST00000108916] [ENSMUST00000108917]
Predicted Effect probably benign
Transcript: ENSMUST00000103065
AA Change: E181K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099354
Gene: ENSMUSG00000027525
AA Change: E181K

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
RPEL 52 77 2.08e0 SMART
low complexity region 187 206 N/A INTRINSIC
RPEL 360 385 5.1e-4 SMART
low complexity region 387 397 N/A INTRINSIC
RPEL 398 423 3.24e-6 SMART
RPEL 436 461 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103066
AA Change: E221K

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525
AA Change: E221K

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
RPEL 92 117 2.08e0 SMART
low complexity region 227 246 N/A INTRINSIC
RPEL 400 425 5.1e-4 SMART
low complexity region 427 437 N/A INTRINSIC
RPEL 438 463 3.24e-6 SMART
RPEL 476 501 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108915
AA Change: E222K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104543
Gene: ENSMUSG00000027525
AA Change: E222K

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
RPEL 93 118 2.08e0 SMART
low complexity region 228 247 N/A INTRINSIC
RPEL 401 426 5.1e-4 SMART
low complexity region 428 438 N/A INTRINSIC
RPEL 439 464 3.24e-6 SMART
RPEL 477 502 9.82e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108916
AA Change: E217K

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525
AA Change: E217K

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 434 459 3.24e-6 SMART
RPEL 472 497 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108917
AA Change: E217K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525
AA Change: E217K

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 436 458 2.74e-4 SMART
RPEL 471 496 9.82e-6 SMART
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Phactr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Phactr3 APN 2 178279062 missense probably benign 0.00
IGL01432:Phactr3 APN 2 178283100 missense probably benign 0.05
IGL01580:Phactr3 APN 2 178269504 splice site probably benign
IGL02688:Phactr3 APN 2 178278999 missense probably damaging 0.96
IGL02985:Phactr3 APN 2 178175457 missense probably benign
PIT4151001:Phactr3 UTSW 2 178334068 missense probably damaging 1.00
R1854:Phactr3 UTSW 2 178283147 missense probably damaging 1.00
R2132:Phactr3 UTSW 2 178283966 missense probably benign 0.14
R3110:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3112:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3122:Phactr3 UTSW 2 178331618 missense probably damaging 1.00
R4193:Phactr3 UTSW 2 178283152 missense probably damaging 0.98
R4194:Phactr3 UTSW 2 178283109 missense possibly damaging 0.80
R4243:Phactr3 UTSW 2 178283189 splice site probably null
R4245:Phactr3 UTSW 2 178283189 splice site probably null
R4397:Phactr3 UTSW 2 178175406 intron probably benign
R4433:Phactr3 UTSW 2 178283132 missense probably damaging 1.00
R4581:Phactr3 UTSW 2 178283172 missense probably damaging 1.00
R4772:Phactr3 UTSW 2 178283936 missense probably damaging 1.00
R4830:Phactr3 UTSW 2 178284018 missense probably damaging 0.98
R5045:Phactr3 UTSW 2 178331619 missense probably damaging 1.00
R5442:Phactr3 UTSW 2 178142461 missense probably benign 0.38
R5461:Phactr3 UTSW 2 178278901 missense probably benign
R5816:Phactr3 UTSW 2 178302793 missense probably damaging 1.00
R6668:Phactr3 UTSW 2 178332864 missense probably damaging 1.00
R7144:Phactr3 UTSW 2 178302736 missense probably damaging 1.00
R7340:Phactr3 UTSW 2 178334061 missense probably damaging 1.00
R7798:Phactr3 UTSW 2 178283910 missense probably benign 0.19
R8009:Phactr3 UTSW 2 178332944 missense probably damaging 1.00
R8074:Phactr3 UTSW 2 178302796 missense probably damaging 1.00
R8348:Phactr3 UTSW 2 178256142 missense probably benign 0.03
R8530:Phactr3 UTSW 2 178284026 missense probably damaging 1.00
Z1176:Phactr3 UTSW 2 178269374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGATCAGTGTCTTCCCACC -3'
(R):5'- TGCTGAGGCAATGACAAGAGTC -3'

Sequencing Primer
(F):5'- GATCAGTGTCTTCCCACCATCAAG -3'
(R):5'- CAAGAGTCAGCCTGGAGC -3'
Posted On2018-03-15