Incidental Mutation 'R6276:Trpc4'
ID507624
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Nametransient receptor potential cation channel, subfamily C, member 4
SynonymsTrrp4, STRPC4, Trp4, CCE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54156035-54318471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54318020 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 846 (E846G)
Ref Sequence ENSEMBL: ENSMUSP00000143593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
Predicted Effect probably benign
Transcript: ENSMUST00000029311
AA Change: E930G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: E930G

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200048
AA Change: E846G

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: E846G

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200341
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54302175 missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54222562 missense probably benign 0.01
IGL01475:Trpc4 APN 3 54266407 missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54302146 missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54266074 splice site probably benign
IGL02134:Trpc4 APN 3 54315654 missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54222362 missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54291232 missense probably damaging 0.97
IGL02549:Trpc4 APN 3 54222349 missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54299246 missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54299274 splice site probably benign
R0498:Trpc4 UTSW 3 54291211 missense probably damaging 1.00
R0555:Trpc4 UTSW 3 54302090 splice site probably benign
R0609:Trpc4 UTSW 3 54194768 missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54195002 missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54315815 missense probably benign 0.02
R1623:Trpc4 UTSW 3 54299179 missense probably damaging 1.00
R1763:Trpc4 UTSW 3 54194822 missense possibly damaging 0.90
R1843:Trpc4 UTSW 3 54279994 missense probably benign 0.19
R1856:Trpc4 UTSW 3 54279989 missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54279890 missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54302193 missense probably benign 0.03
R2441:Trpc4 UTSW 3 54222283 missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54291340 missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54318012 missense probably benign 0.22
R3931:Trpc4 UTSW 3 54318095 missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54302218 missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54194796 missense probably benign 0.11
R5284:Trpc4 UTSW 3 54279947 missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54299178 missense probably damaging 0.99
R5973:Trpc4 UTSW 3 54315842 missense probably damaging 1.00
R6335:Trpc4 UTSW 3 54317574 critical splice donor site probably null
R7082:Trpc4 UTSW 3 54299098 nonsense probably null
R7215:Trpc4 UTSW 3 54194896 missense possibly damaging 0.83
R7299:Trpc4 UTSW 3 54317627 missense possibly damaging 0.87
R7423:Trpc4 UTSW 3 54318029 missense probably benign
R7459:Trpc4 UTSW 3 54291232 missense probably damaging 0.97
R7538:Trpc4 UTSW 3 54318095 missense possibly damaging 0.92
R7542:Trpc4 UTSW 3 54315654 missense probably damaging 1.00
R7823:Trpc4 UTSW 3 54302219 nonsense probably null
R7868:Trpc4 UTSW 3 54302286 missense probably benign 0.00
R7951:Trpc4 UTSW 3 54302286 missense probably benign 0.00
R8046:Trpc4 UTSW 3 54194914 missense probably damaging 1.00
X0066:Trpc4 UTSW 3 54194750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGAAATTACTCGTCAACAGGC -3'
(R):5'- AACATTTTGCCTGCCCAGAG -3'

Sequencing Primer
(F):5'- TTACTCGTCAACAGGCGGCAG -3'
(R):5'- CCCAGAGCACTATGGAAAATATG -3'
Posted On2018-03-15