Incidental Mutation 'R6276:Paxip1'
ID507629
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene NamePAX interacting (with transcription-activation domain) protein 1
SynonymsD5Ertd149e, PTIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location27740080-27791691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27761668 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 620 (I620N)
Ref Sequence ENSEMBL: ENSMUSP00000002291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291]
Predicted Effect probably damaging
Transcript: ENSMUST00000002291
AA Change: I620N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: I620N

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196641
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27772552 utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27748859 missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27751038 missense probably benign 0.17
IGL02143:Paxip1 APN 5 27775598 utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27759395 missense probably benign 0.30
IGL02903:Paxip1 APN 5 27748872 missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27752766 missense probably benign 0.01
BB003:Paxip1 UTSW 5 27791209 missense unknown
BB013:Paxip1 UTSW 5 27791209 missense unknown
R0128:Paxip1 UTSW 5 27744185 splice site probably benign
R0130:Paxip1 UTSW 5 27744185 splice site probably benign
R0331:Paxip1 UTSW 5 27765232 missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27758623 splice site probably benign
R0370:Paxip1 UTSW 5 27760086 missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27765942 nonsense probably null
R1969:Paxip1 UTSW 5 27744136 missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27742501 missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27775673 utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27772029 unclassified probably benign
R3809:Paxip1 UTSW 5 27772029 unclassified probably benign
R3881:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27761677 splice site probably null
R4692:Paxip1 UTSW 5 27772097 unclassified probably benign
R4776:Paxip1 UTSW 5 27765206 missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27766284 missense unknown
R5388:Paxip1 UTSW 5 27781455 utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27772004 unclassified probably benign
R5553:Paxip1 UTSW 5 27775639 utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27761618 missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27766173 missense unknown
R6290:Paxip1 UTSW 5 27765578 splice site probably null
R6584:Paxip1 UTSW 5 27758452 missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27744137 missense probably benign 0.18
R6908:Paxip1 UTSW 5 27791224 missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27765768 nonsense probably null
R7252:Paxip1 UTSW 5 27760086 missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27781420 critical splice donor site probably null
R7585:Paxip1 UTSW 5 27772004 missense unknown
R7665:Paxip1 UTSW 5 27765738 missense unknown
R7926:Paxip1 UTSW 5 27791209 missense unknown
R8169:Paxip1 UTSW 5 27772095 missense unknown
R8335:Paxip1 UTSW 5 27766124 missense unknown
X0066:Paxip1 UTSW 5 27766018 missense unknown
Z1176:Paxip1 UTSW 5 27783729 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTACACACAGCAAGCACTTG -3'
(R):5'- CAAAATGTCCACAGTGCTGGG -3'

Sequencing Primer
(F):5'- GCTTCTAGGGATGAATATAACACTG -3'
(R):5'- GCATTCCTGTTTCTTTGAAATGACTG -3'
Posted On2018-03-15