Incidental Mutation 'R6276:Peg10'
ID507633
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Namepaternally expressed 10
SynonymsHB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6276 (G1)
Quality Score149.467
Status Validated
Chromosome6
Chromosomal Location4747306-4760517 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GAT to GATCAT at 4756449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8239:Peg10 UTSW 6 4756452 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGTGCCACAACCG -3'
(R):5'- ACAGGGTGGTAAATTCTGAATCC -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- CTGAATCCAGCCATGTGGTAG -3'
Posted On2018-03-15