Incidental Mutation 'R6276:Asb4'
ID507634
Institutional Source Beutler Lab
Gene Symbol Asb4
Ensembl Gene ENSMUSG00000042607
Gene Nameankyrin repeat and SOCS box-containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location5383386-5433022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5431043 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 426 (Y426C)
Ref Sequence ENSEMBL: ENSMUSP00000040331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043294]
Predicted Effect probably damaging
Transcript: ENSMUST00000043294
AA Change: Y426C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040331
Gene: ENSMUSG00000042607
AA Change: Y426C

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 4.86e1 SMART
ANK 174 203 2.43e1 SMART
ANK 207 247 1.17e2 SMART
ANK 251 280 8.86e-2 SMART
SOCS_box 381 420 7.48e-10 SMART
Meta Mutation Damage Score 0.2931 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired placentation, embryonic growth arrest, reduced litter size, and pre-eclampsia like features including hypertension and albuminuria in late-stage pregnant females as well as renal defects including glomerular endotheliosis and mesangial expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Asb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Asb4 APN 6 5398386 missense probably benign 0.00
IGL03015:Asb4 APN 6 5398515 missense possibly damaging 0.75
IGL03280:Asb4 APN 6 5423416 missense probably benign
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1267:Asb4 UTSW 6 5423747 missense probably damaging 1.00
R1435:Asb4 UTSW 6 5398410 missense probably benign 0.33
R1595:Asb4 UTSW 6 5390692 missense probably damaging 1.00
R1764:Asb4 UTSW 6 5390798 splice site probably null
R2118:Asb4 UTSW 6 5390687 missense probably benign
R3976:Asb4 UTSW 6 5390771 missense probably benign 0.01
R4020:Asb4 UTSW 6 5390803 splice site probably benign
R4067:Asb4 UTSW 6 5423651 missense probably damaging 1.00
R4469:Asb4 UTSW 6 5423409 missense probably benign 0.01
R4895:Asb4 UTSW 6 5398266 missense probably damaging 0.98
R5432:Asb4 UTSW 6 5430912 missense probably damaging 1.00
R5444:Asb4 UTSW 6 5431040 missense probably damaging 0.98
R6196:Asb4 UTSW 6 5390699 missense probably benign 0.05
R6333:Asb4 UTSW 6 5423597 missense probably damaging 1.00
R6922:Asb4 UTSW 6 5398304 missense possibly damaging 0.87
R7098:Asb4 UTSW 6 5398499 missense probably damaging 1.00
R7196:Asb4 UTSW 6 5423356 missense probably benign 0.00
R7547:Asb4 UTSW 6 5398350 missense probably damaging 1.00
R7561:Asb4 UTSW 6 5430968 missense possibly damaging 0.87
R7707:Asb4 UTSW 6 5430968 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATCTGGGGAAGCTGAGGATCTG -3'
(R):5'- TCCCTCAGCATACTACTCTAGG -3'

Sequencing Primer
(F):5'- GGATCTGCCCTCAAATTAATCTG -3'
(R):5'- CAGCATACTACTCTAGGATTAATGGC -3'
Posted On2018-03-15