Incidental Mutation 'R6276:Garre1'
ID 507640
Institutional Source Beutler Lab
Gene Symbol Garre1
Ensembl Gene ENSMUSG00000066571
Gene Name granule associated Rac and RHOG effector 1
Synonyms 4931406P16Rik
MMRRC Submission 044446-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6276 (G1)
Quality Score 141.008
Status Validated
Chromosome 7
Chromosomal Location 33936132-34012976 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 33941802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 627 (Y627*)
Ref Sequence ENSEMBL: ENSMUSP00000145762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]
AlphaFold Q8C5X1
Predicted Effect probably null
Transcript: ENSMUST00000085592
AA Change: Y839*
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: Y839*

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108074
AA Change: Y839*
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: Y839*

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127010
Predicted Effect probably null
Transcript: ENSMUST00000205264
AA Change: Y123*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206245
Predicted Effect probably null
Transcript: ENSMUST00000206399
AA Change: Y627*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A T 1: 125,322,874 (GRCm39) D364E probably benign Het
Adra2c C T 5: 35,437,423 (GRCm39) T65I probably damaging Het
Agap2 T A 10: 126,925,229 (GRCm39) probably null Het
Ager T C 17: 34,817,728 (GRCm39) V126A possibly damaging Het
Arhgap39 T C 15: 76,621,736 (GRCm39) I288M probably benign Het
Arhgap45 A T 10: 79,862,068 (GRCm39) S541C probably benign Het
Asb4 A G 6: 5,431,043 (GRCm39) Y426C probably damaging Het
Azi2 C T 9: 117,878,406 (GRCm39) T82I probably damaging Het
Baz2b T A 2: 59,778,567 (GRCm39) R764S probably damaging Het
Ccdc146 A C 5: 21,506,338 (GRCm39) I701S probably damaging Het
Ccnq T C 11: 78,642,056 (GRCm39) K145E probably damaging Het
Cd55b T A 1: 130,345,903 (GRCm39) I172F probably damaging Het
Cdk11b A G 4: 155,718,647 (GRCm39) E199G probably benign Het
Cntnap4 A T 8: 113,478,921 (GRCm39) T216S possibly damaging Het
D5Ertd579e A T 5: 36,761,858 (GRCm39) N1336K possibly damaging Het
Dlg5 T C 14: 24,214,636 (GRCm39) N649S probably damaging Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dscaml1 C T 9: 45,579,458 (GRCm39) T335I possibly damaging Het
Epb41l2 G T 10: 25,378,022 (GRCm39) G695C probably damaging Het
Erbb4 C T 1: 68,599,735 (GRCm39) R114H probably damaging Het
F2rl1 G T 13: 95,650,446 (GRCm39) Y145* probably null Het
Fsip2 A T 2: 82,810,785 (GRCm39) Y2368F possibly damaging Het
Galnt7 C T 8: 57,989,612 (GRCm39) probably null Het
Gm6811 T A 17: 21,314,245 (GRCm39) noncoding transcript Het
Gm6811 T G 17: 21,314,952 (GRCm39) noncoding transcript Het
H2-M1 G A 17: 36,982,602 (GRCm39) T86M possibly damaging Het
Hk2 T C 6: 82,720,347 (GRCm39) D170G probably benign Het
Hmcn1 C T 1: 150,614,432 (GRCm39) A1325T possibly damaging Het
Insrr T A 3: 87,707,826 (GRCm39) Y89* probably null Het
Itga1 T C 13: 115,117,388 (GRCm39) E871G probably benign Het
Kat6a T C 8: 23,429,421 (GRCm39) L1592P possibly damaging Het
Kndc1 C A 7: 139,500,979 (GRCm39) A756E probably benign Het
Krt12 A T 11: 99,312,728 (GRCm39) C105* probably null Het
Lama1 G A 17: 68,091,083 (GRCm39) probably null Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lrrk1 A G 7: 65,956,587 (GRCm39) probably null Het
Lypd9 T A 11: 58,337,192 (GRCm39) I94L possibly damaging Het
Map2 T C 1: 66,438,578 (GRCm39) V34A probably damaging Het
Mroh6 A G 15: 75,757,549 (GRCm39) L487P probably damaging Het
Myo18b A T 5: 112,959,508 (GRCm39) S1430T probably benign Het
Notch3 G A 17: 32,373,723 (GRCm39) T495I probably benign Het
Or1e31 A T 11: 73,690,229 (GRCm39) M118K probably damaging Het
Palld C T 8: 61,966,457 (GRCm39) A980T probably damaging Het
Paxip1 A T 5: 27,966,666 (GRCm39) I620N probably damaging Het
Pcdha6 A G 18: 37,102,820 (GRCm39) probably null Het
Pcdhb11 G A 18: 37,554,813 (GRCm39) V48M probably benign Het
Pcdhga6 A G 18: 37,840,697 (GRCm39) E139G probably benign Het
Pck1 T C 2: 172,999,112 (GRCm39) V426A probably damaging Het
Pck2 T A 14: 55,780,081 (GRCm39) I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phactr3 G A 2: 177,920,812 (GRCm39) E222K probably damaging Het
Ppip5k1 A T 2: 121,153,684 (GRCm39) probably benign Het
Prodh2 A G 7: 30,206,076 (GRCm39) H278R probably benign Het
Rspry1 T A 8: 95,349,886 (GRCm39) H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Smn1 A G 13: 100,264,503 (GRCm39) N78S possibly damaging Het
Spta1 T A 1: 174,046,078 (GRCm39) I1614N probably damaging Het
Syt17 T C 7: 118,033,513 (GRCm39) D165G probably damaging Het
Tbck A G 3: 132,448,766 (GRCm39) Y593C probably damaging Het
Tcaf2 G C 6: 42,606,687 (GRCm39) F422L probably benign Het
Tex15 T A 8: 34,067,217 (GRCm39) F2216I possibly damaging Het
Trpc4 A G 3: 54,225,441 (GRCm39) E846G probably benign Het
Ttc41 T C 10: 86,580,313 (GRCm39) I753T probably benign Het
Vdac1 C T 11: 52,267,309 (GRCm39) T70M possibly damaging Het
Vmn1r124 A C 7: 20,994,104 (GRCm39) F147V probably benign Het
Vmn1r220 T C 13: 23,368,465 (GRCm39) D77G probably damaging Het
Vmn2r28 T C 7: 5,493,730 (GRCm39) H72R probably benign Het
Vmn2r78 A T 7: 86,570,318 (GRCm39) I279L probably benign Het
Vmn2r95 G T 17: 18,671,732 (GRCm39) A490S possibly damaging Het
Wdfy4 C T 14: 32,831,482 (GRCm39) A915T possibly damaging Het
Zmiz2 G T 11: 6,345,604 (GRCm39) probably null Het
Zscan2 A G 7: 80,525,557 (GRCm39) N426S probably benign Het
Other mutations in Garre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Garre1 APN 7 33,945,412 (GRCm39) splice site probably benign
IGL00160:Garre1 APN 7 33,938,431 (GRCm39) missense possibly damaging 0.88
IGL00691:Garre1 APN 7 33,944,910 (GRCm39) missense probably damaging 1.00
IGL01312:Garre1 APN 7 33,955,933 (GRCm39) missense probably benign 0.19
IGL01954:Garre1 APN 7 33,944,460 (GRCm39) missense probably damaging 1.00
IGL02016:Garre1 APN 7 33,938,526 (GRCm39) missense possibly damaging 0.74
IGL02390:Garre1 APN 7 33,947,643 (GRCm39) missense probably damaging 1.00
IGL02407:Garre1 APN 7 33,955,909 (GRCm39) missense probably damaging 0.99
IGL02677:Garre1 APN 7 33,941,834 (GRCm39) splice site probably benign
IGL02929:Garre1 APN 7 33,944,507 (GRCm39) missense possibly damaging 0.46
IGL03285:Garre1 APN 7 33,984,416 (GRCm39) missense possibly damaging 0.81
I1329:Garre1 UTSW 7 33,944,619 (GRCm39) missense probably benign 0.00
R0004:Garre1 UTSW 7 33,955,853 (GRCm39) missense probably damaging 0.99
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0135:Garre1 UTSW 7 33,945,382 (GRCm39) missense probably damaging 1.00
R0137:Garre1 UTSW 7 33,938,644 (GRCm39) missense probably damaging 1.00
R0556:Garre1 UTSW 7 33,939,222 (GRCm39) missense probably damaging 0.99
R0687:Garre1 UTSW 7 33,944,843 (GRCm39) missense possibly damaging 0.95
R0928:Garre1 UTSW 7 33,947,671 (GRCm39) splice site probably null
R1719:Garre1 UTSW 7 33,947,631 (GRCm39) missense probably damaging 0.98
R1908:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1909:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1976:Garre1 UTSW 7 33,956,805 (GRCm39) missense probably damaging 0.99
R2496:Garre1 UTSW 7 33,955,916 (GRCm39) missense possibly damaging 0.93
R3005:Garre1 UTSW 7 33,984,209 (GRCm39) missense probably damaging 1.00
R4666:Garre1 UTSW 7 33,984,198 (GRCm39) missense probably damaging 0.98
R4832:Garre1 UTSW 7 33,938,333 (GRCm39) utr 3 prime probably benign
R4870:Garre1 UTSW 7 33,984,312 (GRCm39) missense possibly damaging 0.83
R4989:Garre1 UTSW 7 33,945,225 (GRCm39) missense probably damaging 1.00
R5033:Garre1 UTSW 7 33,945,237 (GRCm39) missense probably benign
R5308:Garre1 UTSW 7 33,945,180 (GRCm39) nonsense probably null
R5366:Garre1 UTSW 7 33,941,713 (GRCm39) missense possibly damaging 0.74
R5386:Garre1 UTSW 7 33,941,813 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,984,134 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,953,416 (GRCm39) missense possibly damaging 0.74
R5714:Garre1 UTSW 7 33,939,941 (GRCm39) nonsense probably null
R5733:Garre1 UTSW 7 33,944,505 (GRCm39) missense probably damaging 0.99
R5772:Garre1 UTSW 7 33,953,413 (GRCm39) missense probably damaging 0.97
R6059:Garre1 UTSW 7 33,944,888 (GRCm39) missense possibly damaging 0.90
R6211:Garre1 UTSW 7 33,938,429 (GRCm39) missense possibly damaging 0.95
R6477:Garre1 UTSW 7 33,957,055 (GRCm39) critical splice donor site probably null
R6757:Garre1 UTSW 7 33,938,502 (GRCm39) missense possibly damaging 0.89
R6912:Garre1 UTSW 7 33,945,093 (GRCm39) missense probably benign
R7156:Garre1 UTSW 7 33,945,133 (GRCm39) missense possibly damaging 0.80
R7317:Garre1 UTSW 7 33,963,072 (GRCm39) missense probably benign
R7431:Garre1 UTSW 7 33,984,219 (GRCm39) missense possibly damaging 0.73
R7452:Garre1 UTSW 7 33,945,096 (GRCm39) missense probably benign
R7996:Garre1 UTSW 7 33,963,024 (GRCm39) missense possibly damaging 0.77
R8348:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8448:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8989:Garre1 UTSW 7 33,956,869 (GRCm39) missense probably damaging 0.99
R9010:Garre1 UTSW 7 33,938,491 (GRCm39) missense probably benign 0.01
R9095:Garre1 UTSW 7 33,956,770 (GRCm39) critical splice donor site probably null
R9505:Garre1 UTSW 7 33,984,371 (GRCm39) missense probably damaging 1.00
R9530:Garre1 UTSW 7 33,963,069 (GRCm39) missense probably benign 0.01
R9612:Garre1 UTSW 7 33,947,656 (GRCm39) missense probably damaging 1.00
RF019:Garre1 UTSW 7 33,939,974 (GRCm39) missense probably damaging 0.98
X0021:Garre1 UTSW 7 33,944,788 (GRCm39) missense possibly damaging 0.94
Z1177:Garre1 UTSW 7 33,984,180 (GRCm39) missense probably damaging 0.96
Z1186:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1186:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1186:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1191:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTCAAAGCAAGGCCGTAAG -3'
(R):5'- TTTCAGTTCAGGGAGTGGCC -3'

Sequencing Primer
(F):5'- GAGGCATCCAGATCCCAAATTTG -3'
(R):5'- TTCAGGGAGTGGCCATAGC -3'
Posted On 2018-03-15