Mutagenetix > Incidental Mutation

Incidental Mutation 'R6276:Lrrk1'

507641

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

044446-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 66306839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably null
Transcript: ENSMUST00000015277

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207140

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Actr3	A	T	1: 125,395,137	D364E	probably benign	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Arhgap45	A	T	10: 80,026,234	S541C	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
Cntnap4	A	T	8: 112,752,289	T216S	possibly damaging	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Galnt7	C	T	8: 57,536,578		probably null	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Rspry1	T	A	8: 94,623,258	H91Q	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Tex15	T	A	8: 33,577,189	F2216I	possibly damaging	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CATCCCGTGCTTTACAAAACGTTG -3'
(R):5'- TCTCTCACTGGTTGGGACTG -3'

Sequencing Primer
(F):5'- CAAAACGTTGTAGCAGCTACTGTG -3'
(R):5'- GGATATGTTTGACCACGCAC -3'

Posted On

2018-03-15