Incidental Mutation 'R6276:Vmn2r78'
ID 507643
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 044446-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6276 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86564557-86604385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86570318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 279 (I279L)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably benign
Transcript: ENSMUST00000170835
AA Change: I279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: I279L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A T 1: 125,322,874 (GRCm39) D364E probably benign Het
Adra2c C T 5: 35,437,423 (GRCm39) T65I probably damaging Het
Agap2 T A 10: 126,925,229 (GRCm39) probably null Het
Ager T C 17: 34,817,728 (GRCm39) V126A possibly damaging Het
Arhgap39 T C 15: 76,621,736 (GRCm39) I288M probably benign Het
Arhgap45 A T 10: 79,862,068 (GRCm39) S541C probably benign Het
Asb4 A G 6: 5,431,043 (GRCm39) Y426C probably damaging Het
Azi2 C T 9: 117,878,406 (GRCm39) T82I probably damaging Het
Baz2b T A 2: 59,778,567 (GRCm39) R764S probably damaging Het
Ccdc146 A C 5: 21,506,338 (GRCm39) I701S probably damaging Het
Ccnq T C 11: 78,642,056 (GRCm39) K145E probably damaging Het
Cd55b T A 1: 130,345,903 (GRCm39) I172F probably damaging Het
Cdk11b A G 4: 155,718,647 (GRCm39) E199G probably benign Het
Cntnap4 A T 8: 113,478,921 (GRCm39) T216S possibly damaging Het
D5Ertd579e A T 5: 36,761,858 (GRCm39) N1336K possibly damaging Het
Dlg5 T C 14: 24,214,636 (GRCm39) N649S probably damaging Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dscaml1 C T 9: 45,579,458 (GRCm39) T335I possibly damaging Het
Epb41l2 G T 10: 25,378,022 (GRCm39) G695C probably damaging Het
Erbb4 C T 1: 68,599,735 (GRCm39) R114H probably damaging Het
F2rl1 G T 13: 95,650,446 (GRCm39) Y145* probably null Het
Fsip2 A T 2: 82,810,785 (GRCm39) Y2368F possibly damaging Het
Galnt7 C T 8: 57,989,612 (GRCm39) probably null Het
Garre1 A T 7: 33,941,802 (GRCm39) Y627* probably null Het
Gm6811 T A 17: 21,314,245 (GRCm39) noncoding transcript Het
Gm6811 T G 17: 21,314,952 (GRCm39) noncoding transcript Het
H2-M1 G A 17: 36,982,602 (GRCm39) T86M possibly damaging Het
Hk2 T C 6: 82,720,347 (GRCm39) D170G probably benign Het
Hmcn1 C T 1: 150,614,432 (GRCm39) A1325T possibly damaging Het
Insrr T A 3: 87,707,826 (GRCm39) Y89* probably null Het
Itga1 T C 13: 115,117,388 (GRCm39) E871G probably benign Het
Kat6a T C 8: 23,429,421 (GRCm39) L1592P possibly damaging Het
Kndc1 C A 7: 139,500,979 (GRCm39) A756E probably benign Het
Krt12 A T 11: 99,312,728 (GRCm39) C105* probably null Het
Lama1 G A 17: 68,091,083 (GRCm39) probably null Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lrrk1 A G 7: 65,956,587 (GRCm39) probably null Het
Lypd9 T A 11: 58,337,192 (GRCm39) I94L possibly damaging Het
Map2 T C 1: 66,438,578 (GRCm39) V34A probably damaging Het
Mroh6 A G 15: 75,757,549 (GRCm39) L487P probably damaging Het
Myo18b A T 5: 112,959,508 (GRCm39) S1430T probably benign Het
Notch3 G A 17: 32,373,723 (GRCm39) T495I probably benign Het
Or1e31 A T 11: 73,690,229 (GRCm39) M118K probably damaging Het
Palld C T 8: 61,966,457 (GRCm39) A980T probably damaging Het
Paxip1 A T 5: 27,966,666 (GRCm39) I620N probably damaging Het
Pcdha6 A G 18: 37,102,820 (GRCm39) probably null Het
Pcdhb11 G A 18: 37,554,813 (GRCm39) V48M probably benign Het
Pcdhga6 A G 18: 37,840,697 (GRCm39) E139G probably benign Het
Pck1 T C 2: 172,999,112 (GRCm39) V426A probably damaging Het
Pck2 T A 14: 55,780,081 (GRCm39) I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phactr3 G A 2: 177,920,812 (GRCm39) E222K probably damaging Het
Ppip5k1 A T 2: 121,153,684 (GRCm39) probably benign Het
Prodh2 A G 7: 30,206,076 (GRCm39) H278R probably benign Het
Rspry1 T A 8: 95,349,886 (GRCm39) H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Smn1 A G 13: 100,264,503 (GRCm39) N78S possibly damaging Het
Spta1 T A 1: 174,046,078 (GRCm39) I1614N probably damaging Het
Syt17 T C 7: 118,033,513 (GRCm39) D165G probably damaging Het
Tbck A G 3: 132,448,766 (GRCm39) Y593C probably damaging Het
Tcaf2 G C 6: 42,606,687 (GRCm39) F422L probably benign Het
Tex15 T A 8: 34,067,217 (GRCm39) F2216I possibly damaging Het
Trpc4 A G 3: 54,225,441 (GRCm39) E846G probably benign Het
Ttc41 T C 10: 86,580,313 (GRCm39) I753T probably benign Het
Vdac1 C T 11: 52,267,309 (GRCm39) T70M possibly damaging Het
Vmn1r124 A C 7: 20,994,104 (GRCm39) F147V probably benign Het
Vmn1r220 T C 13: 23,368,465 (GRCm39) D77G probably damaging Het
Vmn2r28 T C 7: 5,493,730 (GRCm39) H72R probably benign Het
Vmn2r95 G T 17: 18,671,732 (GRCm39) A490S possibly damaging Het
Wdfy4 C T 14: 32,831,482 (GRCm39) A915T possibly damaging Het
Zmiz2 G T 11: 6,345,604 (GRCm39) probably null Het
Zscan2 A G 7: 80,525,557 (GRCm39) N426S probably benign Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86,564,569 (GRCm39) missense unknown
IGL01473:Vmn2r78 APN 7 86,569,520 (GRCm39) missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86,603,643 (GRCm39) missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86,570,687 (GRCm39) missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86,603,496 (GRCm39) missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86,569,969 (GRCm39) nonsense probably null
ANU74:Vmn2r78 UTSW 7 86,570,273 (GRCm39) missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86,569,413 (GRCm39) missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86,572,235 (GRCm39) missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86,570,519 (GRCm39) missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86,603,588 (GRCm39) missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86,571,477 (GRCm39) missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86,564,615 (GRCm39) missense unknown
R1526:Vmn2r78 UTSW 7 86,571,465 (GRCm39) splice site probably null
R1712:Vmn2r78 UTSW 7 86,604,132 (GRCm39) missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86,569,997 (GRCm39) missense probably benign
R1812:Vmn2r78 UTSW 7 86,569,995 (GRCm39) missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86,604,287 (GRCm39) missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86,603,690 (GRCm39) missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86,570,535 (GRCm39) missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86,569,362 (GRCm39) missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86,569,953 (GRCm39) splice site probably benign
R3023:Vmn2r78 UTSW 7 86,604,174 (GRCm39) missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86,569,959 (GRCm39) critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86,569,452 (GRCm39) missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86,570,399 (GRCm39) missense probably benign
R4546:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86,603,916 (GRCm39) missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86,603,835 (GRCm39) missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86,571,563 (GRCm39) missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86,569,332 (GRCm39) missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86,570,238 (GRCm39) missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86,569,330 (GRCm39) missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86,570,737 (GRCm39) missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86,564,720 (GRCm39) missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86,603,637 (GRCm39) missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86,603,796 (GRCm39) missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86,604,115 (GRCm39) missense probably benign 0.00
R5977:Vmn2r78 UTSW 7 86,569,541 (GRCm39) missense possibly damaging 0.74
R6386:Vmn2r78 UTSW 7 86,571,545 (GRCm39) nonsense probably null
R6724:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86,571,558 (GRCm39) missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86,571,633 (GRCm39) missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86,603,552 (GRCm39) nonsense probably null
R7680:Vmn2r78 UTSW 7 86,604,149 (GRCm39) missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86,570,343 (GRCm39) missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86,569,378 (GRCm39) nonsense probably null
R8031:Vmn2r78 UTSW 7 86,604,075 (GRCm39) missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86,571,695 (GRCm39) missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86,603,998 (GRCm39) missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86,603,660 (GRCm39) missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86,570,094 (GRCm39) missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86,603,513 (GRCm39) missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86,569,431 (GRCm39) missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86,603,639 (GRCm39) nonsense probably null
Z1177:Vmn2r78 UTSW 7 86,603,982 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r78 UTSW 7 86,570,415 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACTGGGTAGGAGTCATCATTACAG -3'
(R):5'- AGTTAGATGGGTGCACTGTC -3'

Sequencing Primer
(F):5'- CAGATGATGACCATGGAATTCAGTTC -3'
(R):5'- TGTCTGCATAAATTGTTTAAAACCAG -3'
Posted On 2018-03-15