Mutagenetix > Incidental Mutation

Incidental Mutation 'R6276:Tex15'

507647

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33577189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 2216 (F2216I)

Ref Sequence

ENSEMBL: ENSMUSP00000009772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009772
AA Change: F2216I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: F2216I

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124496

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Actr3	A	T	1: 125,395,137	D364E	probably benign	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Arhgap45	A	T	10: 80,026,234	S541C	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
Cntnap4	A	T	8: 112,752,289	T216S	possibly damaging	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Galnt7	C	T	8: 57,536,578		probably null	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lrrk1	A	G	7: 66,306,839		probably null	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Rspry1	T	A	8: 94,623,258	H91Q	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
R9618:Tex15	UTSW	8	33572369	missense	probably benign	0.35
R9655:Tex15	UTSW	8	33576756	nonsense	probably null
R9786:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R9798:Tex15	UTSW	8	33572693	missense	probably damaging	0.98
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GTCCTTAAGAAAGAGCTGGCTG -3'
(R):5'- GCAAAGCATTCCTTTTGTTGCG -3'

Sequencing Primer
(F):5'- CCTTAAGAAAGAGCTGGCTGTTATC -3'
(R):5'- CGCAGCATTTGGAGAAAGAG -3'

Posted On

2018-03-15