Mutagenetix > Incidental Mutation

Incidental Mutation 'R6276:Galnt7'

507648

Institutional Source

Beutler Lab

Gene Symbol

Galnt7

Ensembl Gene

ENSMUSG00000031608

Gene Name

polypeptide N-acetylgalactosaminyltransferase 7

Synonyms

ppGaNTase-T7

MMRRC Submission

044446-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.844) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57523828-57653032 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 57536578 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]

AlphaFold

Q80VA0

Predicted Effect

probably null
Transcript: ENSMUST00000034021

SMART Domains

Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	3e-28	PFAM
Pfam:Glyco_tranf_2_2	210	490	2e-7	PFAM
Pfam:Glyco_transf_7C	375	445	1.8e-8	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110316

SMART Domains

Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	8.2e-27	PFAM
Pfam:Glyco_tranf_2_2	210	490	1.3e-7	PFAM
Pfam:Glyco_transf_7C	369	445	9.3e-9	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139417

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Actr3	A	T	1: 125,395,137	D364E	probably benign	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Arhgap45	A	T	10: 80,026,234	S541C	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
Cntnap4	A	T	8: 112,752,289	T216S	possibly damaging	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lrrk1	A	G	7: 66,306,839		probably null	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Rspry1	T	A	8: 94,623,258	H91Q	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Tex15	T	A	8: 33,577,189	F2216I	possibly damaging	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Galnt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Galnt7	APN	8	57540039	missense	probably damaging	1.00
IGL00538:Galnt7	APN	8	57552522	missense	possibly damaging	0.95
IGL00826:Galnt7	APN	8	57540071	nonsense	probably null
IGL00951:Galnt7	APN	8	57583824	missense	probably damaging	0.96
IGL01662:Galnt7	APN	8	57531735	splice site	probably benign
IGL02280:Galnt7	APN	8	57536790	missense	probably damaging	1.00
IGL02832:Galnt7	APN	8	57552497	missense	probably damaging	1.00
IGL02936:Galnt7	APN	8	57584214	missense	probably benign
IGL03083:Galnt7	APN	8	57526189	missense	probably damaging	0.98
IGL03387:Galnt7	APN	8	57526178	missense	probably benign	0.01
R0400:Galnt7	UTSW	8	57583989	missense	probably damaging	0.99
R0553:Galnt7	UTSW	8	57552430	splice site	probably benign
R1463:Galnt7	UTSW	8	57652858	missense	probably benign
R1487:Galnt7	UTSW	8	57540039	missense	probably damaging	1.00
R1791:Galnt7	UTSW	8	57542530	missense	probably benign	0.05
R1817:Galnt7	UTSW	8	57538178	missense	probably damaging	1.00
R1962:Galnt7	UTSW	8	57532714	missense	probably benign	0.13
R3855:Galnt7	UTSW	8	57532624	splice site	probably benign
R3856:Galnt7	UTSW	8	57532624	splice site	probably benign
R4232:Galnt7	UTSW	8	57652966	missense	probably benign
R4396:Galnt7	UTSW	8	57538181	missense	probably damaging	1.00
R4426:Galnt7	UTSW	8	57552572	nonsense	probably null
R4610:Galnt7	UTSW	8	57545769	missense	probably damaging	0.99
R4745:Galnt7	UTSW	8	57542727	intron	probably benign
R4794:Galnt7	UTSW	8	57545363	missense	probably damaging	1.00
R5014:Galnt7	UTSW	8	57545380	missense	probably damaging	1.00
R5177:Galnt7	UTSW	8	57584027	missense	possibly damaging	0.87
R5682:Galnt7	UTSW	8	57583933	nonsense	probably null
R6122:Galnt7	UTSW	8	57526166	missense	probably damaging	0.99
R6684:Galnt7	UTSW	8	57538109	missense	probably benign	0.16
R6752:Galnt7	UTSW	8	57652951	missense	probably damaging	1.00
R7464:Galnt7	UTSW	8	57584020	missense	possibly damaging	0.95
R7491:Galnt7	UTSW	8	57552518	missense	probably damaging	0.97
R7547:Galnt7	UTSW	8	57583962	missense	possibly damaging	0.48
R8093:Galnt7	UTSW	8	57532705	missense	probably benign	0.00
R8221:Galnt7	UTSW	8	57552566	missense	possibly damaging	0.93
R8248:Galnt7	UTSW	8	57538188	missense	probably benign	0.34
R8402:Galnt7	UTSW	8	57542919	missense	probably damaging	0.98
R8779:Galnt7	UTSW	8	57584211	missense	probably benign
R8894:Galnt7	UTSW	8	57526142	nonsense	probably null
R8974:Galnt7	UTSW	8	57652900	missense
R9106:Galnt7	UTSW	8	57532695	missense	probably damaging	1.00
R9297:Galnt7	UTSW	8	57542521	missense	probably damaging	0.98
X0050:Galnt7	UTSW	8	57552444	frame shift	probably null
X0062:Galnt7	UTSW	8	57583908	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTTGCTGACAGTCAAGTGTGC -3'
(R):5'- TTCTATGCTAGCCGTCCTGAG -3'

Sequencing Primer
(F):5'- CTGACAGTCAAGTGTGCAAAGGC -3'
(R):5'- TATGCTAGCCGTCCTGAGTCAAAG -3'

Posted On

2018-03-15