Incidental Mutation 'R6276:Palld'
ID 507649
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Name palladin, cytoskeletal associated protein
Synonyms 2410003B16Rik
MMRRC Submission 044446-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6276 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 61964467-62355724 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 61966457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 980 (A980T)
Ref Sequence ENSEMBL: ENSMUSP00000113874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
AlphaFold Q9ET54
Predicted Effect probably benign
Transcript: ENSMUST00000034057
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121200
AA Change: A641T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: A641T

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121493
AA Change: A980T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: A980T

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121785
AA Change: A1386T
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: A1386T

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135439
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153495
Meta Mutation Damage Score 0.1477 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A T 1: 125,322,874 (GRCm39) D364E probably benign Het
Adra2c C T 5: 35,437,423 (GRCm39) T65I probably damaging Het
Agap2 T A 10: 126,925,229 (GRCm39) probably null Het
Ager T C 17: 34,817,728 (GRCm39) V126A possibly damaging Het
Arhgap39 T C 15: 76,621,736 (GRCm39) I288M probably benign Het
Arhgap45 A T 10: 79,862,068 (GRCm39) S541C probably benign Het
Asb4 A G 6: 5,431,043 (GRCm39) Y426C probably damaging Het
Azi2 C T 9: 117,878,406 (GRCm39) T82I probably damaging Het
Baz2b T A 2: 59,778,567 (GRCm39) R764S probably damaging Het
Ccdc146 A C 5: 21,506,338 (GRCm39) I701S probably damaging Het
Ccnq T C 11: 78,642,056 (GRCm39) K145E probably damaging Het
Cd55b T A 1: 130,345,903 (GRCm39) I172F probably damaging Het
Cdk11b A G 4: 155,718,647 (GRCm39) E199G probably benign Het
Cntnap4 A T 8: 113,478,921 (GRCm39) T216S possibly damaging Het
D5Ertd579e A T 5: 36,761,858 (GRCm39) N1336K possibly damaging Het
Dlg5 T C 14: 24,214,636 (GRCm39) N649S probably damaging Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dscaml1 C T 9: 45,579,458 (GRCm39) T335I possibly damaging Het
Epb41l2 G T 10: 25,378,022 (GRCm39) G695C probably damaging Het
Erbb4 C T 1: 68,599,735 (GRCm39) R114H probably damaging Het
F2rl1 G T 13: 95,650,446 (GRCm39) Y145* probably null Het
Fsip2 A T 2: 82,810,785 (GRCm39) Y2368F possibly damaging Het
Galnt7 C T 8: 57,989,612 (GRCm39) probably null Het
Garre1 A T 7: 33,941,802 (GRCm39) Y627* probably null Het
Gm6811 T A 17: 21,314,245 (GRCm39) noncoding transcript Het
Gm6811 T G 17: 21,314,952 (GRCm39) noncoding transcript Het
H2-M1 G A 17: 36,982,602 (GRCm39) T86M possibly damaging Het
Hk2 T C 6: 82,720,347 (GRCm39) D170G probably benign Het
Hmcn1 C T 1: 150,614,432 (GRCm39) A1325T possibly damaging Het
Insrr T A 3: 87,707,826 (GRCm39) Y89* probably null Het
Itga1 T C 13: 115,117,388 (GRCm39) E871G probably benign Het
Kat6a T C 8: 23,429,421 (GRCm39) L1592P possibly damaging Het
Kndc1 C A 7: 139,500,979 (GRCm39) A756E probably benign Het
Krt12 A T 11: 99,312,728 (GRCm39) C105* probably null Het
Lama1 G A 17: 68,091,083 (GRCm39) probably null Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lrrk1 A G 7: 65,956,587 (GRCm39) probably null Het
Lypd9 T A 11: 58,337,192 (GRCm39) I94L possibly damaging Het
Map2 T C 1: 66,438,578 (GRCm39) V34A probably damaging Het
Mroh6 A G 15: 75,757,549 (GRCm39) L487P probably damaging Het
Myo18b A T 5: 112,959,508 (GRCm39) S1430T probably benign Het
Notch3 G A 17: 32,373,723 (GRCm39) T495I probably benign Het
Or1e31 A T 11: 73,690,229 (GRCm39) M118K probably damaging Het
Paxip1 A T 5: 27,966,666 (GRCm39) I620N probably damaging Het
Pcdha6 A G 18: 37,102,820 (GRCm39) probably null Het
Pcdhb11 G A 18: 37,554,813 (GRCm39) V48M probably benign Het
Pcdhga6 A G 18: 37,840,697 (GRCm39) E139G probably benign Het
Pck1 T C 2: 172,999,112 (GRCm39) V426A probably damaging Het
Pck2 T A 14: 55,780,081 (GRCm39) I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phactr3 G A 2: 177,920,812 (GRCm39) E222K probably damaging Het
Ppip5k1 A T 2: 121,153,684 (GRCm39) probably benign Het
Prodh2 A G 7: 30,206,076 (GRCm39) H278R probably benign Het
Rspry1 T A 8: 95,349,886 (GRCm39) H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Smn1 A G 13: 100,264,503 (GRCm39) N78S possibly damaging Het
Spta1 T A 1: 174,046,078 (GRCm39) I1614N probably damaging Het
Syt17 T C 7: 118,033,513 (GRCm39) D165G probably damaging Het
Tbck A G 3: 132,448,766 (GRCm39) Y593C probably damaging Het
Tcaf2 G C 6: 42,606,687 (GRCm39) F422L probably benign Het
Tex15 T A 8: 34,067,217 (GRCm39) F2216I possibly damaging Het
Trpc4 A G 3: 54,225,441 (GRCm39) E846G probably benign Het
Ttc41 T C 10: 86,580,313 (GRCm39) I753T probably benign Het
Vdac1 C T 11: 52,267,309 (GRCm39) T70M possibly damaging Het
Vmn1r124 A C 7: 20,994,104 (GRCm39) F147V probably benign Het
Vmn1r220 T C 13: 23,368,465 (GRCm39) D77G probably damaging Het
Vmn2r28 T C 7: 5,493,730 (GRCm39) H72R probably benign Het
Vmn2r78 A T 7: 86,570,318 (GRCm39) I279L probably benign Het
Vmn2r95 G T 17: 18,671,732 (GRCm39) A490S possibly damaging Het
Wdfy4 C T 14: 32,831,482 (GRCm39) A915T possibly damaging Het
Zmiz2 G T 11: 6,345,604 (GRCm39) probably null Het
Zscan2 A G 7: 80,525,557 (GRCm39) N426S probably benign Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61,968,969 (GRCm39) missense possibly damaging 0.77
IGL01083:Palld APN 8 61,991,841 (GRCm39) missense probably benign 0.44
IGL01644:Palld APN 8 62,330,512 (GRCm39) missense probably benign 0.28
IGL01672:Palld APN 8 62,330,536 (GRCm39) missense probably benign 0.22
IGL01941:Palld APN 8 61,988,734 (GRCm39) missense probably benign 0.44
IGL02037:Palld APN 8 61,978,148 (GRCm39) missense probably damaging 1.00
IGL02126:Palld APN 8 62,330,476 (GRCm39) missense possibly damaging 0.82
IGL02537:Palld APN 8 62,137,968 (GRCm39) missense probably benign 0.05
IGL02632:Palld APN 8 61,968,279 (GRCm39) missense probably damaging 1.00
IGL02809:Palld APN 8 61,968,281 (GRCm39) missense probably damaging 1.00
IGL02901:Palld APN 8 62,330,029 (GRCm39) nonsense probably null
IGL03400:Palld APN 8 61,966,489 (GRCm39) missense probably damaging 1.00
R0098:Palld UTSW 8 61,978,120 (GRCm39) missense probably damaging 1.00
R0098:Palld UTSW 8 61,978,120 (GRCm39) missense probably damaging 1.00
R0745:Palld UTSW 8 62,330,737 (GRCm39) missense probably damaging 1.00
R1263:Palld UTSW 8 61,966,491 (GRCm39) frame shift probably null
R1342:Palld UTSW 8 61,975,916 (GRCm39) critical splice donor site probably null
R1893:Palld UTSW 8 61,969,655 (GRCm39) missense probably damaging 1.00
R2017:Palld UTSW 8 62,137,799 (GRCm39) missense probably damaging 0.99
R2102:Palld UTSW 8 61,986,467 (GRCm39) missense possibly damaging 0.82
R2129:Palld UTSW 8 62,330,395 (GRCm39) missense probably benign 0.00
R2246:Palld UTSW 8 62,330,169 (GRCm39) missense probably benign 0.01
R3545:Palld UTSW 8 62,003,112 (GRCm39) missense possibly damaging 0.95
R3815:Palld UTSW 8 62,002,871 (GRCm39) intron probably benign
R3824:Palld UTSW 8 62,162,067 (GRCm39) missense probably damaging 1.00
R4412:Palld UTSW 8 62,140,406 (GRCm39) missense probably damaging 0.98
R4781:Palld UTSW 8 62,330,062 (GRCm39) missense probably benign 0.01
R4836:Palld UTSW 8 62,140,415 (GRCm39) missense probably benign 0.11
R4871:Palld UTSW 8 62,002,815 (GRCm39) intron probably benign
R4963:Palld UTSW 8 62,156,244 (GRCm39) missense probably damaging 1.00
R5036:Palld UTSW 8 62,003,196 (GRCm39) missense probably damaging 1.00
R5128:Palld UTSW 8 62,173,622 (GRCm39) missense probably damaging 1.00
R5343:Palld UTSW 8 62,002,849 (GRCm39) intron probably benign
R5421:Palld UTSW 8 61,969,584 (GRCm39) missense probably damaging 1.00
R5427:Palld UTSW 8 62,003,106 (GRCm39) missense probably benign 0.01
R5561:Palld UTSW 8 61,969,619 (GRCm39) missense probably damaging 1.00
R5651:Palld UTSW 8 61,991,822 (GRCm39) missense probably damaging 1.00
R5679:Palld UTSW 8 62,137,979 (GRCm39) missense possibly damaging 0.95
R5915:Palld UTSW 8 61,986,386 (GRCm39) critical splice donor site probably null
R6153:Palld UTSW 8 62,003,186 (GRCm39) missense probably damaging 1.00
R6323:Palld UTSW 8 62,173,727 (GRCm39) missense probably damaging 1.00
R6659:Palld UTSW 8 61,986,477 (GRCm39) missense probably benign 0.28
R7016:Palld UTSW 8 61,969,032 (GRCm39) missense probably damaging 1.00
R7124:Palld UTSW 8 61,969,679 (GRCm39) missense unknown
R7145:Palld UTSW 8 61,985,051 (GRCm39) missense unknown
R7386:Palld UTSW 8 61,985,086 (GRCm39) missense unknown
R7407:Palld UTSW 8 61,968,975 (GRCm39) nonsense probably null
R7723:Palld UTSW 8 62,164,492 (GRCm39) missense probably damaging 1.00
R8029:Palld UTSW 8 62,330,346 (GRCm39) missense probably damaging 1.00
R8402:Palld UTSW 8 62,164,440 (GRCm39) missense probably damaging 1.00
R8775:Palld UTSW 8 62,138,006 (GRCm39) missense possibly damaging 0.73
R8775-TAIL:Palld UTSW 8 62,138,006 (GRCm39) missense possibly damaging 0.73
R8887:Palld UTSW 8 61,986,512 (GRCm39) missense unknown
R8906:Palld UTSW 8 62,003,198 (GRCm39) critical splice donor site probably null
R8969:Palld UTSW 8 62,137,883 (GRCm39) missense probably damaging 1.00
R8971:Palld UTSW 8 61,969,735 (GRCm39) missense unknown
R8990:Palld UTSW 8 61,968,279 (GRCm39) missense probably damaging 1.00
R9012:Palld UTSW 8 62,173,697 (GRCm39) missense possibly damaging 0.85
R9145:Palld UTSW 8 62,330,107 (GRCm39) missense probably benign 0.01
R9221:Palld UTSW 8 61,969,591 (GRCm39) missense unknown
R9228:Palld UTSW 8 62,173,571 (GRCm39) missense probably damaging 1.00
R9311:Palld UTSW 8 61,978,189 (GRCm39) missense unknown
R9355:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9376:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9377:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9378:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9467:Palld UTSW 8 61,968,264 (GRCm39) missense unknown
R9638:Palld UTSW 8 62,002,788 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TAAGCATCACCTACTTAGACTCTC -3'
(R):5'- CTTAAGCCTCTAAGGGATTTCCAAG -3'

Sequencing Primer
(F):5'- TCCCATAATGCGACAGAG -3'
(R):5'- GCCTCTAAGGGATTTCCAAGTATATC -3'
Posted On 2018-03-15