Mutagenetix > Incidental Mutation

Incidental Mutation 'R6276:Rspry1'

507650

Institutional Source

Beutler Lab

Gene Symbol

Rspry1

Ensembl Gene

ENSMUSG00000050079

Gene Name

ring finger and SPRY domain containing 1

Synonyms

4930470D19Rik

MMRRC Submission

044446-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.505) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94601937-94660275 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94623258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 91 (H91Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]

AlphaFold

Q8BVR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000060389
AA Change: H91Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: H91Q

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	30	39	N/A	INTRINSIC
low complexity region	74	95	N/A	INTRINSIC
SPRY	358	482	2.94e-26	SMART
RING	527	561	3.93e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121101
AA Change: H91Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: H91Q

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	30	39	N/A	INTRINSIC
low complexity region	74	95	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211983
AA Change: H91Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000212729

Meta Mutation Damage Score

0.0770

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Actr3	A	T	1: 125,395,137	D364E	probably benign	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Arhgap45	A	T	10: 80,026,234	S541C	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
Cntnap4	A	T	8: 112,752,289	T216S	possibly damaging	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Galnt7	C	T	8: 57,536,578		probably null	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lrrk1	A	G	7: 66,306,839		probably null	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Tex15	T	A	8: 33,577,189	F2216I	possibly damaging	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Rspry1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rspry1	APN	8	94622986	start codon destroyed	probably null	0.89
IGL00158:Rspry1	APN	8	94622980	intron	probably benign
IGL01141:Rspry1	APN	8	94649855	missense	probably benign	0.00
IGL01860:Rspry1	APN	8	94649816	missense	probably benign	0.00
IGL02174:Rspry1	APN	8	94633140	missense	possibly damaging	0.84
IGL02819:Rspry1	APN	8	94654256	missense	probably benign	0.42
IGL02926:Rspry1	APN	8	94649811	missense	probably damaging	1.00
IGL03366:Rspry1	APN	8	94650334	missense	probably benign	0.00
R0570:Rspry1	UTSW	8	94629792	missense	probably damaging	1.00
R1833:Rspry1	UTSW	8	94635488	missense	probably damaging	1.00
R1988:Rspry1	UTSW	8	94632054	critical splice acceptor site	probably null
R2444:Rspry1	UTSW	8	94623107	missense	probably damaging	1.00
R3623:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R3624:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R4275:Rspry1	UTSW	8	94649761	missense	probably benign	0.00
R4888:Rspry1	UTSW	8	94658789	missense	probably benign	0.19
R5026:Rspry1	UTSW	8	94650303	missense	probably damaging	1.00
R5310:Rspry1	UTSW	8	94623185	missense	probably benign
R5374:Rspry1	UTSW	8	94623008	missense	probably benign	0.00
R5374:Rspry1	UTSW	8	94654264	missense	probably benign	0.38
R5387:Rspry1	UTSW	8	94638286	missense	possibly damaging	0.95
R5517:Rspry1	UTSW	8	94636760	splice site	probably null
R5631:Rspry1	UTSW	8	94629078	start codon destroyed	possibly damaging	0.79
R5653:Rspry1	UTSW	8	94636611	splice site	probably null
R6065:Rspry1	UTSW	8	94622987	start codon destroyed	probably null	0.98
R6220:Rspry1	UTSW	8	94658750	missense	probably damaging	1.00
R6821:Rspry1	UTSW	8	94635431	nonsense	probably null
R7390:Rspry1	UTSW	8	94623185	missense	probably benign
R7460:Rspry1	UTSW	8	94650335	missense	probably benign	0.00
R7644:Rspry1	UTSW	8	94658768	missense	probably benign	0.00
R7717:Rspry1	UTSW	8	94623122	missense	probably damaging	1.00
R7768:Rspry1	UTSW	8	94629841	missense	probably damaging	1.00
R7940:Rspry1	UTSW	8	94623007	missense	probably benign	0.22
R7978:Rspry1	UTSW	8	94623125	missense	probably damaging	0.98
R8087:Rspry1	UTSW	8	94654297	missense	probably benign	0.04
R8174:Rspry1	UTSW	8	94649822	missense	probably damaging	0.97
R8326:Rspry1	UTSW	8	94639589	missense	probably damaging	1.00
R8676:Rspry1	UTSW	8	94632119	missense	probably benign	0.01
R8715:Rspry1	UTSW	8	94623260	missense	probably damaging	0.98
R8869:Rspry1	UTSW	8	94633152	missense	probably damaging	0.97
R9253:Rspry1	UTSW	8	94622993	missense	probably damaging	1.00
R9281:Rspry1	UTSW	8	94636631	missense	probably damaging	1.00
R9699:Rspry1	UTSW	8	94654229	missense	probably benign	0.01
X0010:Rspry1	UTSW	8	94629801	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- TGCTGACTCTTGAGGAGCAC -3'
(R):5'- GCACAAGGCTTGGAAAATATATCC -3'

Sequencing Primer
(F):5'- CTGACTCTTGAGGAGCACATAGC -3'
(R):5'- TATATCCTAACTGAGTGGAAGGAGTC -3'

Posted On

2018-03-15