Incidental Mutation 'R6276:Cntnap4'
ID 507651
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Name contactin associated protein-like 4
Synonyms Caspr4, E130114F09Rik
MMRRC Submission 044446-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6276 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 113296675-113609349 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113478921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 216 (T216S)
Ref Sequence ENSEMBL: ENSMUSP00000112511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
AlphaFold Q99P47
Predicted Effect possibly damaging
Transcript: ENSMUST00000034225
AA Change: T216S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: T216S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118171
AA Change: T216S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: T216S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125976
Meta Mutation Damage Score 0.1579 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A T 1: 125,322,874 (GRCm39) D364E probably benign Het
Adra2c C T 5: 35,437,423 (GRCm39) T65I probably damaging Het
Agap2 T A 10: 126,925,229 (GRCm39) probably null Het
Ager T C 17: 34,817,728 (GRCm39) V126A possibly damaging Het
Arhgap39 T C 15: 76,621,736 (GRCm39) I288M probably benign Het
Arhgap45 A T 10: 79,862,068 (GRCm39) S541C probably benign Het
Asb4 A G 6: 5,431,043 (GRCm39) Y426C probably damaging Het
Azi2 C T 9: 117,878,406 (GRCm39) T82I probably damaging Het
Baz2b T A 2: 59,778,567 (GRCm39) R764S probably damaging Het
Ccdc146 A C 5: 21,506,338 (GRCm39) I701S probably damaging Het
Ccnq T C 11: 78,642,056 (GRCm39) K145E probably damaging Het
Cd55b T A 1: 130,345,903 (GRCm39) I172F probably damaging Het
Cdk11b A G 4: 155,718,647 (GRCm39) E199G probably benign Het
D5Ertd579e A T 5: 36,761,858 (GRCm39) N1336K possibly damaging Het
Dlg5 T C 14: 24,214,636 (GRCm39) N649S probably damaging Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dscaml1 C T 9: 45,579,458 (GRCm39) T335I possibly damaging Het
Epb41l2 G T 10: 25,378,022 (GRCm39) G695C probably damaging Het
Erbb4 C T 1: 68,599,735 (GRCm39) R114H probably damaging Het
F2rl1 G T 13: 95,650,446 (GRCm39) Y145* probably null Het
Fsip2 A T 2: 82,810,785 (GRCm39) Y2368F possibly damaging Het
Galnt7 C T 8: 57,989,612 (GRCm39) probably null Het
Garre1 A T 7: 33,941,802 (GRCm39) Y627* probably null Het
Gm6811 T A 17: 21,314,245 (GRCm39) noncoding transcript Het
Gm6811 T G 17: 21,314,952 (GRCm39) noncoding transcript Het
H2-M1 G A 17: 36,982,602 (GRCm39) T86M possibly damaging Het
Hk2 T C 6: 82,720,347 (GRCm39) D170G probably benign Het
Hmcn1 C T 1: 150,614,432 (GRCm39) A1325T possibly damaging Het
Insrr T A 3: 87,707,826 (GRCm39) Y89* probably null Het
Itga1 T C 13: 115,117,388 (GRCm39) E871G probably benign Het
Kat6a T C 8: 23,429,421 (GRCm39) L1592P possibly damaging Het
Kndc1 C A 7: 139,500,979 (GRCm39) A756E probably benign Het
Krt12 A T 11: 99,312,728 (GRCm39) C105* probably null Het
Lama1 G A 17: 68,091,083 (GRCm39) probably null Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lrrk1 A G 7: 65,956,587 (GRCm39) probably null Het
Lypd9 T A 11: 58,337,192 (GRCm39) I94L possibly damaging Het
Map2 T C 1: 66,438,578 (GRCm39) V34A probably damaging Het
Mroh6 A G 15: 75,757,549 (GRCm39) L487P probably damaging Het
Myo18b A T 5: 112,959,508 (GRCm39) S1430T probably benign Het
Notch3 G A 17: 32,373,723 (GRCm39) T495I probably benign Het
Or1e31 A T 11: 73,690,229 (GRCm39) M118K probably damaging Het
Palld C T 8: 61,966,457 (GRCm39) A980T probably damaging Het
Paxip1 A T 5: 27,966,666 (GRCm39) I620N probably damaging Het
Pcdha6 A G 18: 37,102,820 (GRCm39) probably null Het
Pcdhb11 G A 18: 37,554,813 (GRCm39) V48M probably benign Het
Pcdhga6 A G 18: 37,840,697 (GRCm39) E139G probably benign Het
Pck1 T C 2: 172,999,112 (GRCm39) V426A probably damaging Het
Pck2 T A 14: 55,780,081 (GRCm39) I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Phactr3 G A 2: 177,920,812 (GRCm39) E222K probably damaging Het
Ppip5k1 A T 2: 121,153,684 (GRCm39) probably benign Het
Prodh2 A G 7: 30,206,076 (GRCm39) H278R probably benign Het
Rspry1 T A 8: 95,349,886 (GRCm39) H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Smn1 A G 13: 100,264,503 (GRCm39) N78S possibly damaging Het
Spta1 T A 1: 174,046,078 (GRCm39) I1614N probably damaging Het
Syt17 T C 7: 118,033,513 (GRCm39) D165G probably damaging Het
Tbck A G 3: 132,448,766 (GRCm39) Y593C probably damaging Het
Tcaf2 G C 6: 42,606,687 (GRCm39) F422L probably benign Het
Tex15 T A 8: 34,067,217 (GRCm39) F2216I possibly damaging Het
Trpc4 A G 3: 54,225,441 (GRCm39) E846G probably benign Het
Ttc41 T C 10: 86,580,313 (GRCm39) I753T probably benign Het
Vdac1 C T 11: 52,267,309 (GRCm39) T70M possibly damaging Het
Vmn1r124 A C 7: 20,994,104 (GRCm39) F147V probably benign Het
Vmn1r220 T C 13: 23,368,465 (GRCm39) D77G probably damaging Het
Vmn2r28 T C 7: 5,493,730 (GRCm39) H72R probably benign Het
Vmn2r78 A T 7: 86,570,318 (GRCm39) I279L probably benign Het
Vmn2r95 G T 17: 18,671,732 (GRCm39) A490S possibly damaging Het
Wdfy4 C T 14: 32,831,482 (GRCm39) A915T possibly damaging Het
Zmiz2 G T 11: 6,345,604 (GRCm39) probably null Het
Zscan2 A G 7: 80,525,557 (GRCm39) N426S probably benign Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 113,494,251 (GRCm39) splice site probably benign
IGL01898:Cntnap4 APN 8 113,582,939 (GRCm39) missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 113,478,866 (GRCm39) missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 113,343,126 (GRCm39) missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 113,512,535 (GRCm39) splice site probably benign
IGL02621:Cntnap4 APN 8 113,537,355 (GRCm39) missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 113,500,222 (GRCm39) missense probably benign 0.06
IGL03327:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
IGL03346:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 113,512,416 (GRCm39) missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 113,569,148 (GRCm39) critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 113,583,143 (GRCm39) nonsense probably null
R0497:Cntnap4 UTSW 8 113,296,783 (GRCm39) missense probably benign 0.00
R1495:Cntnap4 UTSW 8 113,608,395 (GRCm39) missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 113,608,462 (GRCm39) missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 113,484,155 (GRCm39) missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 113,542,128 (GRCm39) missense probably benign 0.10
R2160:Cntnap4 UTSW 8 113,484,203 (GRCm39) missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 113,484,071 (GRCm39) missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R3917:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R4097:Cntnap4 UTSW 8 113,478,939 (GRCm39) missense probably benign 0.03
R4348:Cntnap4 UTSW 8 113,480,554 (GRCm39) missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 113,391,898 (GRCm39) missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 113,584,842 (GRCm39) missense probably benign 0.32
R4531:Cntnap4 UTSW 8 113,537,240 (GRCm39) missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 113,537,342 (GRCm39) missense probably benign
R4611:Cntnap4 UTSW 8 113,500,371 (GRCm39) critical splice donor site probably null
R4675:Cntnap4 UTSW 8 113,512,468 (GRCm39) missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 113,460,070 (GRCm39) missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 113,568,385 (GRCm39) missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 113,602,061 (GRCm39) missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 113,569,353 (GRCm39) missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 113,529,843 (GRCm39) missense probably damaging 0.99
R6483:Cntnap4 UTSW 8 113,484,105 (GRCm39) missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 113,529,858 (GRCm39) missense probably benign 0.03
R7031:Cntnap4 UTSW 8 113,584,874 (GRCm39) missense probably benign 0.01
R7107:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 113,537,268 (GRCm39) missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 113,608,432 (GRCm39) missense probably benign 0.05
R7232:Cntnap4 UTSW 8 113,391,731 (GRCm39) splice site probably null
R7348:Cntnap4 UTSW 8 113,391,909 (GRCm39) missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 113,460,194 (GRCm39) critical splice donor site probably null
R7832:Cntnap4 UTSW 8 113,484,113 (GRCm39) missense probably benign
R7895:Cntnap4 UTSW 8 113,478,829 (GRCm39) missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 113,480,577 (GRCm39) missense probably damaging 0.99
R8185:Cntnap4 UTSW 8 113,391,897 (GRCm39) missense probably damaging 1.00
R8197:Cntnap4 UTSW 8 113,296,857 (GRCm39) missense probably benign 0.00
R8287:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
R8299:Cntnap4 UTSW 8 113,500,324 (GRCm39) missense probably damaging 1.00
R8498:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense possibly damaging 0.52
R8699:Cntnap4 UTSW 8 113,484,228 (GRCm39) missense probably damaging 1.00
R8774:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8774-TAIL:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8872:Cntnap4 UTSW 8 113,585,759 (GRCm39) missense possibly damaging 0.79
R8895:Cntnap4 UTSW 8 113,479,598 (GRCm39) missense probably benign 0.40
R8965:Cntnap4 UTSW 8 113,479,646 (GRCm39) missense probably damaging 1.00
R9189:Cntnap4 UTSW 8 113,602,600 (GRCm39) missense possibly damaging 0.92
R9260:Cntnap4 UTSW 8 113,500,276 (GRCm39) missense probably benign 0.08
R9474:Cntnap4 UTSW 8 113,460,103 (GRCm39) missense probably damaging 0.99
R9565:Cntnap4 UTSW 8 113,582,982 (GRCm39) missense probably benign 0.43
R9625:Cntnap4 UTSW 8 113,602,181 (GRCm39) missense possibly damaging 0.82
R9629:Cntnap4 UTSW 8 113,568,349 (GRCm39) missense probably damaging 1.00
R9745:Cntnap4 UTSW 8 113,391,808 (GRCm39) missense possibly damaging 0.89
R9765:Cntnap4 UTSW 8 113,568,496 (GRCm39) missense probably damaging 0.97
R9765:Cntnap4 UTSW 8 113,484,110 (GRCm39) missense probably benign 0.00
R9793:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
R9795:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
X0025:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 113,542,152 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 113,584,821 (GRCm39) missense possibly damaging 0.70
Z1186:Cntnap4 UTSW 8 113,479,002 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGGTCTGACATCACACAC -3'
(R):5'- TCGATGTTAAAGGAAGTGGGCTATG -3'

Sequencing Primer
(F):5'- GTTGGTCTGACATCACACACATTCAC -3'
(R):5'- GTGGGCTATGAAAACATCAAGTTAC -3'
Posted On 2018-03-15