Mutagenetix > Incidental Mutation

Incidental Mutation 'R6276:Cntnap4'

507651

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

E130114F09Rik, Caspr4

MMRRC Submission

044446-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112570043-112882717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112752289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 216 (T216S)

Ref Sequence

ENSEMBL: ENSMUSP00000112511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034225
AA Change: T216S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: T216S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118171
AA Change: T216S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: T216S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125196

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125976

Meta Mutation Damage Score

0.1579

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Actr3	A	T	1: 125,395,137	D364E	probably benign	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Arhgap45	A	T	10: 80,026,234	S541C	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Galnt7	C	T	8: 57,536,578		probably null	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lrrk1	A	G	7: 66,306,839		probably null	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Rspry1	T	A	8: 94,623,258	H91Q	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Tex15	T	A	8: 33,577,189	F2216I	possibly damaging	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	112767619	splice site	probably benign
IGL01898:Cntnap4	APN	8	112856307	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	112752234	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	112616494	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	112785903	splice site	probably benign
IGL02621:Cntnap4	APN	8	112810723	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	112773590	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	112773576	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	112773576	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	112785784	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	112842516	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	112856511	nonsense	probably null
R0497:Cntnap4	UTSW	8	112570151	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	112881763	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	112881830	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	112757523	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	112815496	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	112757571	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	112757439	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	112752307	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	112753922	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	112665266	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	112858210	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	112810608	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	112810710	missense	probably benign
R4611:Cntnap4	UTSW	8	112773739	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	112785836	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	112733438	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	112841753	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	112875429	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	112842721	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	112803211	missense	probably damaging	0.99
R6483:Cntnap4	UTSW	8	112757473	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	112803226	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	112858242	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	112810636	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	112881800	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	112665099	splice site	probably null
R7348:Cntnap4	UTSW	8	112665277	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	112733562	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	112757481	missense	probably benign
R7895:Cntnap4	UTSW	8	112752197	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	112753945	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	112665265	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	112570225	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	112773692	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	112875579	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	112757596	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	112859127	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	112752966	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	112753014	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	112875968	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	112773644	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	112733471	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	112856350	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	112875549	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	112841717	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	112665176	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	112757478	missense	probably benign	0.00
R9765:Cntnap4	UTSW	8	112841864	missense	probably damaging	0.97
R9793:Cntnap4	UTSW	8	112881725	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	112881725	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	112875579	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	112815520	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	112858189	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	112752370	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTTGGTCTGACATCACACAC -3'
(R):5'- TCGATGTTAAAGGAAGTGGGCTATG -3'

Sequencing Primer
(F):5'- GTTGGTCTGACATCACACACATTCAC -3'
(R):5'- GTGGGCTATGAAAACATCAAGTTAC -3'

Posted On

2018-03-15