Incidental Mutation 'R6276:Dscaml1'
ID507652
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene NameDS cell adhesion molecule like 1
Synonyms4921507G06Rik, 4930435C18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R6276 (G1)
Quality Score222.009
Status Validated
Chromosome9
Chromosomal Location45426628-45753712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45668160 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 335 (T335I)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592] [ENSMUST00000213919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034592
AA Change: T335I

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: T335I

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213919
Predicted Effect probably benign
Transcript: ENSMUST00000216078
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45670200 nonsense probably null
IGL00497:Dscaml1 APN 9 45752238 missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45751253 missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45683672 missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45702662 splice site probably benign
IGL01125:Dscaml1 APN 9 45749632 critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45752328 nonsense probably null
IGL01356:Dscaml1 APN 9 45746857 missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45742683 nonsense probably null
IGL01552:Dscaml1 APN 9 45447908 missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45683782 missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45746943 nonsense probably null
IGL02095:Dscaml1 APN 9 45447703 missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45683701 missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45745116 missense probably benign
IGL02262:Dscaml1 APN 9 45732080 missense probably benign 0.44
IGL02340:Dscaml1 APN 9 45670176 missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45744328 unclassified probably benign
IGL02619:Dscaml1 APN 9 45447796 missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45447897 missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45670103 missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45684325 missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45742999 missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45742680 nonsense probably null
R0582:Dscaml1 UTSW 9 45668264 missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45721418 missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45732134 missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45745074 missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45752349 splice site probably benign
R1449:Dscaml1 UTSW 9 45742223 missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45685221 missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45672643 missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45450584 missense probably damaging 0.99
R1542:Dscaml1 UTSW 9 45749440 missense possibly damaging 0.84
R1572:Dscaml1 UTSW 9 45721333 missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45753147 missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45672749 missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45752690 missense possibly damaging 0.49
R1777:Dscaml1 UTSW 9 45683756 missense possibly damaging 0.58
R1812:Dscaml1 UTSW 9 45751286 critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45683632 missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45740480 missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45670224 missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45750132 missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45685234 missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45745078 missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45732137 missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45717484 missense possibly damaging 0.84
R4110:Dscaml1 UTSW 9 45732068 missense probably benign 0.07
R4706:Dscaml1 UTSW 9 45450580 missense probably damaging 1.00
R4716:Dscaml1 UTSW 9 45450592 missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45672695 missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45670106 missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45745189 missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45717432 missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45450559 missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45745185 missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45721298 missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6415:Dscaml1 UTSW 9 45683677 nonsense probably null
R6527:Dscaml1 UTSW 9 45712184 nonsense probably null
R6582:Dscaml1 UTSW 9 45752806 missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45746937 missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45710311 missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45683830 missense probably damaging 0.99
R6918:Dscaml1 UTSW 9 45430507 missense probably benign
R6967:Dscaml1 UTSW 9 45674523 missense probably damaging 0.97
R7214:Dscaml1 UTSW 9 45670139 missense probably benign 0.01
R7286:Dscaml1 UTSW 9 45742746 critical splice donor site probably null
R7315:Dscaml1 UTSW 9 45745125 missense probably benign 0.00
R7338:Dscaml1 UTSW 9 45674504 missense probably benign 0.12
R7343:Dscaml1 UTSW 9 45752916 missense probably benign
R7395:Dscaml1 UTSW 9 45702405 missense possibly damaging 0.73
R7439:Dscaml1 UTSW 9 45710326 missense possibly damaging 0.94
R7484:Dscaml1 UTSW 9 45749446 splice site probably null
R7545:Dscaml1 UTSW 9 45685383 missense probably benign 0.11
R7979:Dscaml1 UTSW 9 45683731 missense probably damaging 1.00
R8005:Dscaml1 UTSW 9 45717510 missense probably damaging 1.00
R8181:Dscaml1 UTSW 9 45746842 missense possibly damaging 0.86
R8262:Dscaml1 UTSW 9 45747140 intron probably benign
R8428:Dscaml1 UTSW 9 45742586 missense probably benign 0.00
R8725:Dscaml1 UTSW 9 45430461 missense probably benign 0.00
R8727:Dscaml1 UTSW 9 45430461 missense probably benign 0.00
R8796:Dscaml1 UTSW 9 45447728 missense probably damaging 0.99
R8840:Dscaml1 UTSW 9 45723420 missense probably damaging 0.99
X0058:Dscaml1 UTSW 9 45752128 missense probably benign 0.00
Z1177:Dscaml1 UTSW 9 45672791 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCCAGACCCTGCAGAGTC -3'
(R):5'- GCCATTAGGAGCCCTTCTTG -3'

Sequencing Primer
(F):5'- AGAGTCCATCCCTACCATCCTGG -3'
(R):5'- GGTCCTGGTATTACATCACACAGAG -3'
Posted On2018-03-15