Mutagenetix > Incidental Mutations

Incidental Mutation 'R6276:Arhgap45'

507655

Institutional Source

Beutler Lab

Gene Symbol

Arhgap45

Ensembl Gene

ENSMUSG00000035697

Gene Name

Rho GTPase activating protein 45

Synonyms

6330406L22Rik, Hmha1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80016653-80031472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80026234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 541 (S541C)

Ref Sequence

ENSEMBL: ENSMUSP00000101012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043311
AA Change: S414C

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: S414C

Domain	Start	End	E-Value	Type
low complexity region	142	153	N/A	INTRINSIC
FCH	157	244	4.14e-17	SMART
low complexity region	255	269	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	330	345	N/A	INTRINSIC
low complexity region	527	536	N/A	INTRINSIC
C1	582	628	3.15e-8	SMART
RhoGAP	653	852	2.73e-73	SMART
low complexity region	856	869	N/A	INTRINSIC
Blast:RhoGAP	876	999	1e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000099501
AA Change: S530C

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: S530C

Domain	Start	End	E-Value	Type
low complexity region	258	269	N/A	INTRINSIC
FCH	273	360	4.14e-17	SMART
low complexity region	371	385	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	446	461	N/A	INTRINSIC
low complexity region	643	652	N/A	INTRINSIC
C1	698	744	3.15e-8	SMART
RhoGAP	769	968	2.73e-73	SMART
low complexity region	972	985	N/A	INTRINSIC
Blast:RhoGAP	992	1115	1e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105373
AA Change: S541C

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: S541C

Domain	Start	End	E-Value	Type
low complexity region	269	280	N/A	INTRINSIC
FCH	284	371	4.14e-17	SMART
low complexity region	382	396	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	457	472	N/A	INTRINSIC
low complexity region	654	663	N/A	INTRINSIC
C1	709	755	3.15e-8	SMART
RhoGAP	780	979	2.73e-73	SMART
low complexity region	983	996	N/A	INTRINSIC
Blast:RhoGAP	1003	1126	1e-21	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150022

Meta Mutation Damage Score

0.0834

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	T	A	11: 58,446,366	I94L	possibly damaging	Het
4931406P16Rik	A	T	7: 34,242,377	Y627*	probably null	Het
Actr3	A	T	1: 125,395,137	D364E	probably benign	Het
Adra2c	C	T	5: 35,280,079	T65I	probably damaging	Het
Agap2	T	A	10: 127,089,360		probably null	Het
Ager	T	C	17: 34,598,754	V126A	possibly damaging	Het
Arhgap39	T	C	15: 76,737,536	I288M	probably benign	Het
Asb4	A	G	6: 5,431,043	Y426C	probably damaging	Het
Azi2	C	T	9: 118,049,338	T82I	probably damaging	Het
Baz2b	T	A	2: 59,948,223	R764S	probably damaging	Het
Ccdc146	A	C	5: 21,301,340	I701S	probably damaging	Het
Cd55b	T	A	1: 130,418,166	I172F	probably damaging	Het
Cdk11b	A	G	4: 155,634,190	E199G	probably benign	Het
Cntnap4	A	T	8: 112,752,289	T216S	possibly damaging	Het
D5Ertd579e	A	T	5: 36,604,514	N1336K	possibly damaging	Het
Dlg5	T	C	14: 24,164,568	N649S	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dscaml1	C	T	9: 45,668,160	T335I	possibly damaging	Het
Epb41l2	G	T	10: 25,502,124	G695C	probably damaging	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
F2rl1	G	T	13: 95,513,938	Y145*	probably null	Het
Fam58b	T	C	11: 78,751,230	K145E	probably damaging	Het
Fsip2	A	T	2: 82,980,441	Y2368F	possibly damaging	Het
Galnt7	C	T	8: 57,536,578		probably null	Het
Gm6811	T	A	17: 21,093,983		noncoding transcript	Het
Gm6811	T	G	17: 21,094,690		noncoding transcript	Het
H2-M1	G	A	17: 36,671,710	T86M	possibly damaging	Het
Hk2	T	C	6: 82,743,366	D170G	probably benign	Het
Hmcn1	C	T	1: 150,738,681	A1325T	possibly damaging	Het
Insrr	T	A	3: 87,800,519	Y89*	probably null	Het
Itga1	T	C	13: 114,980,852	E871G	probably benign	Het
Kat6a	T	C	8: 22,939,405	L1592P	possibly damaging	Het
Kndc1	C	A	7: 139,921,063	A756E	probably benign	Het
Krt12	A	T	11: 99,421,902	C105*	probably null	Het
Lama1	G	A	17: 67,784,088		probably null	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lrrk1	A	G	7: 66,306,839		probably null	Het
Map2	T	C	1: 66,399,419	V34A	probably damaging	Het
Mroh6	A	G	15: 75,885,700	L487P	probably damaging	Het
Myo18b	A	T	5: 112,811,642	S1430T	probably benign	Het
Notch3	G	A	17: 32,154,749	T495I	probably benign	Het
Olfr391-ps	A	T	11: 73,799,403	M118K	probably damaging	Het
Palld	C	T	8: 61,513,423	A980T	probably damaging	Het
Paxip1	A	T	5: 27,761,668	I620N	probably damaging	Het
Pcdha6	A	G	18: 36,969,767		probably null	Het
Pcdhb11	G	A	18: 37,421,760	V48M	probably benign	Het
Pcdhga6	A	G	18: 37,707,644	E139G	probably benign	Het
Pck1	T	C	2: 173,157,319	V426A	probably damaging	Het
Pck2	T	A	14: 55,542,624	I110N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phactr3	G	A	2: 178,279,019	E222K	probably damaging	Het
Ppip5k1	A	T	2: 121,323,203		probably benign	Het
Prodh2	A	G	7: 30,506,651	H278R	probably benign	Het
Rspry1	T	A	8: 94,623,258	H91Q	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Smn1	A	G	13: 100,127,995	N78S	possibly damaging	Het
Spta1	T	A	1: 174,218,512	I1614N	probably damaging	Het
Syt17	T	C	7: 118,434,290	D165G	probably damaging	Het
Tbck	A	G	3: 132,743,005	Y593C	probably damaging	Het
Tcaf2	G	C	6: 42,629,753	F422L	probably benign	Het
Tex15	T	A	8: 33,577,189	F2216I	possibly damaging	Het
Trpc4	A	G	3: 54,318,020	E846G	probably benign	Het
Ttc41	T	C	10: 86,744,449	I753T	probably benign	Het
Vdac1	C	T	11: 52,376,482	T70M	possibly damaging	Het
Vmn1r124	A	C	7: 21,260,179	F147V	probably benign	Het
Vmn1r220	T	C	13: 23,184,295	D77G	probably damaging	Het
Vmn2r28	T	C	7: 5,490,731	H72R	probably benign	Het
Vmn2r78	A	T	7: 86,921,110	I279L	probably benign	Het
Vmn2r95	G	T	17: 18,451,470	A490S	possibly damaging	Het
Wdfy4	C	T	14: 33,109,525	A915T	possibly damaging	Het
Zmiz2	G	T	11: 6,395,604		probably null	Het
Zscan2	A	G	7: 80,875,809	N426S	probably benign	Het

Other mutations in Arhgap45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Arhgap45	APN	10	80028648	splice site	probably benign
IGL01414:Arhgap45	APN	10	80027104	missense	probably damaging	1.00
IGL01505:Arhgap45	APN	10	80026542	missense	probably benign	0.10
IGL02203:Arhgap45	APN	10	80027553	nonsense	probably null
IGL02557:Arhgap45	APN	10	80021638	missense	probably damaging	1.00
IGL02858:Arhgap45	APN	10	80017934	missense	probably benign	0.20
IGL03292:Arhgap45	APN	10	80020969	missense	probably benign	0.04
IGL03352:Arhgap45	APN	10	80030751	missense	probably damaging	0.96
Celt	UTSW	10	80020818	missense	probably damaging	1.00
celtic	UTSW	10	80027589	nonsense	probably null
druid	UTSW	10	80026347	critical splice donor site	probably null
Mistletoe	UTSW	10	80027102	nonsense	probably null
Roman	UTSW	10	80027597	missense	probably damaging	1.00
stonehenge	UTSW	10	80025482	missense	possibly damaging	0.81
IGL03048:Arhgap45	UTSW	10	80017017	missense	probably damaging	0.99
PIT4677001:Arhgap45	UTSW	10	80020749	missense	probably benign
R0532:Arhgap45	UTSW	10	80022083	missense	possibly damaging	0.92
R1233:Arhgap45	UTSW	10	80027582	missense	probably damaging	1.00
R1579:Arhgap45	UTSW	10	80028977	missense	probably damaging	1.00
R1666:Arhgap45	UTSW	10	80028750	missense	possibly damaging	0.82
R1668:Arhgap45	UTSW	10	80028750	missense	possibly damaging	0.82
R1688:Arhgap45	UTSW	10	80029095	missense	probably damaging	1.00
R1710:Arhgap45	UTSW	10	80018098	nonsense	probably null
R1902:Arhgap45	UTSW	10	80025466	missense	probably damaging	0.99
R1912:Arhgap45	UTSW	10	80020690	missense	probably benign	0.08
R1935:Arhgap45	UTSW	10	80030954	missense	probably damaging	1.00
R1936:Arhgap45	UTSW	10	80030954	missense	probably damaging	1.00
R1955:Arhgap45	UTSW	10	80026492	missense	probably benign	0.15
R1968:Arhgap45	UTSW	10	80027702	missense	probably damaging	1.00
R1977:Arhgap45	UTSW	10	80020818	missense	probably damaging	1.00
R1986:Arhgap45	UTSW	10	80020696	missense	probably damaging	1.00
R2074:Arhgap45	UTSW	10	80027180	missense	probably damaging	1.00
R2081:Arhgap45	UTSW	10	80027674	missense	probably damaging	1.00
R2162:Arhgap45	UTSW	10	80016979	start codon destroyed	probably null	0.02
R2937:Arhgap45	UTSW	10	80029002	missense	probably damaging	1.00
R2938:Arhgap45	UTSW	10	80029002	missense	probably damaging	1.00
R3081:Arhgap45	UTSW	10	80026447	missense	probably damaging	1.00
R4695:Arhgap45	UTSW	10	80025530	missense	probably damaging	1.00
R4736:Arhgap45	UTSW	10	80026172	missense	probably damaging	1.00
R4758:Arhgap45	UTSW	10	80030293	missense	probably benign	0.00
R4860:Arhgap45	UTSW	10	80027066	missense	probably damaging	1.00
R4860:Arhgap45	UTSW	10	80027066	missense	probably damaging	1.00
R4934:Arhgap45	UTSW	10	80020957	missense	probably damaging	1.00
R4943:Arhgap45	UTSW	10	80026503	missense	probably benign	0.00
R5102:Arhgap45	UTSW	10	80021428	missense	probably benign	0.01
R5128:Arhgap45	UTSW	10	80030959	missense	probably benign	0.16
R5667:Arhgap45	UTSW	10	80025476	missense	probably damaging	1.00
R5671:Arhgap45	UTSW	10	80025476	missense	probably damaging	1.00
R5920:Arhgap45	UTSW	10	80029131	missense	possibly damaging	0.87
R5998:Arhgap45	UTSW	10	80030950	missense	probably damaging	0.99
R6675:Arhgap45	UTSW	10	80018104	missense	probably null	0.98
R6738:Arhgap45	UTSW	10	80027597	missense	probably damaging	1.00
R6783:Arhgap45	UTSW	10	80017864	missense	possibly damaging	0.92
R6863:Arhgap45	UTSW	10	80017782	missense	probably benign	0.03
R6978:Arhgap45	UTSW	10	80021848	missense	probably benign	0.00
R7089:Arhgap45	UTSW	10	80026347	critical splice donor site	probably null
R7215:Arhgap45	UTSW	10	80025482	missense	possibly damaging	0.81
R7307:Arhgap45	UTSW	10	80029182	missense	probably benign	0.14
R7308:Arhgap45	UTSW	10	80026558	critical splice donor site	probably null
R7480:Arhgap45	UTSW	10	80027102	nonsense	probably null
R7481:Arhgap45	UTSW	10	80022300	missense	possibly damaging	0.80
R7649:Arhgap45	UTSW	10	80031001	missense	probably benign	0.00
R7652:Arhgap45	UTSW	10	80028838	missense	probably benign	0.01
R7748:Arhgap45	UTSW	10	80016932	unclassified	probably benign
R7883:Arhgap45	UTSW	10	80027589	nonsense	probably null
R8121:Arhgap45	UTSW	10	80018075	missense	probably damaging	0.99
R8687:Arhgap45	UTSW	10	80016787	unclassified	probably benign
R8866:Arhgap45	UTSW	10	80017916	missense	probably damaging	1.00
R8905:Arhgap45	UTSW	10	80019736	missense	probably benign	0.00
R9299:Arhgap45	UTSW	10	80026731	missense	possibly damaging	0.82
R9412:Arhgap45	UTSW	10	80019730	start codon destroyed	probably null	0.66
X0023:Arhgap45	UTSW	10	80030800	missense	probably damaging	0.98
X0063:Arhgap45	UTSW	10	80030356	missense	possibly damaging	0.51
Z1176:Arhgap45	UTSW	10	80025536	missense	probably damaging	1.00
Z1176:Arhgap45	UTSW	10	80029052	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGGTCCTTGTCTAGTGTGAAC -3'
(R):5'- TCCGTGTACGCATGATTGGG -3'

Sequencing Primer
(F):5'- CCTTGTCTAGTGTGAACTCTATGG -3'
(R):5'- TCAGTAAGAGGCCTCCCCAG -3'

Posted On

2018-03-15