Incidental Mutation 'R6276:Ager'
ID507678
Institutional Source Beutler Lab
Gene Symbol Ager
Ensembl Gene ENSMUSG00000015452
Gene Nameadvanced glycosylation end product-specific receptor
SynonymsRAGE
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34597862-34600936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34598754 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 126 (V126A)
Ref Sequence ENSEMBL: ENSMUSP00000134401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000015622] [ENSMUST00000038149] [ENSMUST00000173328] [ENSMUST00000173992] [ENSMUST00000174069] [ENSMUST00000174496] [ENSMUST00000174532] [ENSMUST00000183827]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015596
AA Change: V126A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452
AA Change: V126A

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015622
SMART Domains Protein: ENSMUSP00000015622
Gene: ENSMUSG00000015478

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RING 27 67 1.5e-8 SMART
transmembrane domain 118 140 N/A INTRINSIC
transmembrane domain 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038149
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172932
SMART Domains Protein: ENSMUSP00000133660
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173229
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173589
SMART Domains Protein: ENSMUSP00000133845
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173992
AA Change: V117A

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452
AA Change: V117A

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174045
Predicted Effect possibly damaging
Transcript: ENSMUST00000174069
AA Change: V126A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452
AA Change: V126A

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174496
AA Change: V126A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452
AA Change: V126A

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174640
Predicted Effect probably benign
Transcript: ENSMUST00000174532
SMART Domains Protein: ENSMUSP00000133744
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 148 3.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183827
SMART Domains Protein: ENSMUSP00000139079
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 183 9.5e-98 PFAM
HOX 184 249 1.9e-18 SMART
low complexity region 267 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184805
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for a null allele show increased bone mass and strength, reduced osteoclast number, abnormal blood vessel healing, and altered development of nephropathy and pain perception in induced diabetes. Homozygotes for another null allele show restored diabetes-induced angiogenic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Ager
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Ager APN 17 34599457 missense probably damaging 0.97
IGL02143:Ager APN 17 34599118 missense probably damaging 1.00
IGL02219:Ager APN 17 34600120 missense probably damaging 0.97
R1337:Ager UTSW 17 34600622 critical splice donor site probably null
R1584:Ager UTSW 17 34600718 missense probably damaging 1.00
R2269:Ager UTSW 17 34599150 missense probably damaging 1.00
R5804:Ager UTSW 17 34598183 missense probably damaging 0.98
R5881:Ager UTSW 17 34600077 missense probably damaging 1.00
R5939:Ager UTSW 17 34598201 missense probably damaging 1.00
R6551:Ager UTSW 17 34599468 splice site probably null
R7009:Ager UTSW 17 34600736 missense probably damaging 1.00
R8212:Ager UTSW 17 34600612 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCCCAGGCTAAGTCACTTTGC -3'
(R):5'- CCATCGGGAATCAGAAGTTTCC -3'

Sequencing Primer
(F):5'- CAGGCTAAGTCACTTTGCATTTATC -3'
(R):5'- GAAGTTTCCCATCTAAGTGCCAG -3'
Posted On2018-03-15