Incidental Mutation 'R6276:Pcdha6'
ID507682
Institutional Source Beutler Lab
Gene Symbol Pcdha6
Ensembl Gene ENSMUSG00000103707
Gene Nameprotocadherin alpha 6
SynonymsCrnr2, Cnr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36967631-37187657 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 36969767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192178
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
AA Change: E671G

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707
AA Change: E671G

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
AA Change: E671G

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707
AA Change: E671G

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Meta Mutation Damage Score 0.6110 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
F2rl1 G T 13: 95,513,938 Y145* probably null Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in Pcdha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3734:Pcdha6 UTSW 18 36969401 missense probably damaging 1.00
R3859:Pcdha6 UTSW 18 36969931 missense possibly damaging 0.89
R3875:Pcdha6 UTSW 18 36968066 missense probably damaging 1.00
R4446:Pcdha6 UTSW 18 36967760 missense probably benign 0.28
R4647:Pcdha6 UTSW 18 36969136 missense probably damaging 0.98
R4659:Pcdha6 UTSW 18 36969239 missense probably damaging 1.00
R4780:Pcdha6 UTSW 18 36969853 missense probably damaging 1.00
R4839:Pcdha6 UTSW 18 36968432 missense possibly damaging 0.73
R4915:Pcdha6 UTSW 18 36968457 missense probably damaging 1.00
R5011:Pcdha6 UTSW 18 36967907 missense probably damaging 1.00
R5084:Pcdha6 UTSW 18 36968963 missense probably damaging 1.00
R5090:Pcdha6 UTSW 18 36968717 missense probably benign 0.15
R5189:Pcdha6 UTSW 18 36968791 missense probably damaging 1.00
R5652:Pcdha6 UTSW 18 36968836 unclassified probably null
R5773:Pcdha6 UTSW 18 36969590 missense probably benign 0.00
R5890:Pcdha6 UTSW 18 36969068 missense possibly damaging 0.94
R6135:Pcdha6 UTSW 18 36969216 missense probably damaging 1.00
R6346:Pcdha6 UTSW 18 36968060 missense probably damaging 1.00
R6889:Pcdha6 UTSW 18 36968343 missense probably damaging 1.00
R7295:Pcdha6 UTSW 18 36968136 missense probably damaging 1.00
R7776:Pcdha6 UTSW 18 36969981 missense probably benign 0.27
Z1088:Pcdha6 UTSW 18 36969217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGATGCGGATTCTGGC -3'
(R):5'- ACCCTCTGTAGGTGGAACTG -3'

Sequencing Primer
(F):5'- CTGCATCCTTTAGCAGGTGGAAC -3'
(R):5'- CTCTGTAGGTGGAACTGAGCAC -3'
Posted On2018-03-15