Mutagenetix > Incidental Mutation

Incidental Mutation 'R6277:Lct'

507686

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

Accession Numbers

Genbank: NM_001081078; MGI:104576

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6277 (G1)

Quality Score

159.009

Status

Validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128304237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 625 (Y625F)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

AlphaFold

F8VPT3

Predicted Effect

probably benign
Transcript: ENSMUST00000073490
AA Change: Y625F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: Y625F

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.2%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,663,694	Y105H	possibly damaging	Het
4921539E11Rik	A	T	4: 103,231,471	Y179*	probably null	Het
Abca7	G	C	10: 80,006,158	V1042L	probably benign	Het
Adck5	C	A	15: 76,593,263	T99K	possibly damaging	Het
Adcy5	A	G	16: 35,289,526	T823A	probably benign	Het
Adra1d	G	T	2: 131,561,163	R336S	probably damaging	Het
Arhgap39	A	T	15: 76,735,137	M749K	probably damaging	Het
Arid4a	A	G	12: 71,039,891	R168G	possibly damaging	Het
Atxn10	A	G	15: 85,391,692	T317A	probably benign	Het
Bicc1	T	C	10: 71,027,901	K22E	possibly damaging	Het
Cacna1b	T	G	2: 24,730,796	T281P	probably damaging	Het
Ccdc174	A	T	6: 91,880,291	Q26L	probably damaging	Het
Celf3	T	C	3: 94,485,365	C124R	probably damaging	Het
Cfap44	A	G	16: 44,437,306	E1068G	probably benign	Het
Crybg1	T	A	10: 43,997,259	E1284D	probably benign	Het
Dcbld2	T	A	16: 58,451,756	Y392N	probably damaging	Het
Dcbld2	C	T	16: 58,465,503	P675L	probably damaging	Het
Dnah12	A	T	14: 26,770,482	H1193L	probably damaging	Het
Ern2	A	G	7: 122,186,107	F16L	probably benign	Het
Fam163b	G	T	2: 27,112,751	T78N	probably benign	Het
Fbxw21	A	T	9: 109,145,555	I299K	possibly damaging	Het
Foxg1	A	G	12: 49,385,516	N344S	probably benign	Het
Git2	A	G	5: 114,733,247	I202T	probably damaging	Het
Gm11595	G	T	11: 99,772,684	P57T	unknown	Het
Gm11639	G	C	11: 105,010,322	E4422D	possibly damaging	Het
Gm12258	G	A	11: 58,854,287	V15M	probably damaging	Het
Gm13119	A	G	4: 144,363,653	E421G	probably damaging	Het
Gm15056	C	T	8: 20,900,898	G40S	probably damaging	Het
Gm960	G	T	19: 4,627,222	S466*	probably null	Het
Gnal	C	A	18: 67,213,072	H274Q	probably damaging	Het
Hormad2	A	T	11: 4,421,583		probably null	Het
Ighv7-2	A	G	12: 113,912,467	I6T	probably benign	Het
Irf9	A	G	14: 55,607,652	D323G	probably benign	Het
Klhl23	G	T	2: 69,833,752	D482Y	probably damaging	Het
Lama4	A	G	10: 39,106,010	N1745S	probably damaging	Het
Lrrc26	T	C	2: 25,290,104	V39A	probably benign	Het
Mllt6	G	A	11: 97,673,948	A527T	probably damaging	Het
Mrgprb4	T	A	7: 48,198,901	D93V	probably benign	Het
Nlrp5	A	G	7: 23,421,455	D698G	probably damaging	Het
Olfr62	T	A	4: 118,666,323	S269T	probably benign	Het
Pacsin1	T	A	17: 27,705,995		probably null	Het
Padi3	A	T	4: 140,791,161		probably null	Het
Pcdha8	T	C	18: 36,994,358	I631T	probably damaging	Het
Pkn3	G	A	2: 30,082,945	G315D	possibly damaging	Het
Ppfibp1	T	A	6: 147,005,924	D228E	probably benign	Het
Prag1	G	T	8: 36,146,591	R1099L	probably damaging	Het
Prr36	A	G	8: 4,214,746		probably benign	Het
Prrc2c	A	G	1: 162,714,314	S369P	probably benign	Het
Ptprn2	A	G	12: 116,876,180	D441G	probably benign	Het
Slc9c1	G	A	16: 45,606,841		probably benign	Het
Slit1	G	A	19: 41,600,509	T1513I	possibly damaging	Het
Smcr8	C	T	11: 60,778,809	T261M	probably benign	Het
Spata17	G	A	1: 187,193,954	R60*	probably null	Het
Speer4f1	A	G	5: 17,476,243	R40G	probably damaging	Het
Spns3	A	G	11: 72,529,640	V340A	possibly damaging	Het
Srgap3	T	C	6: 112,739,383	I595V	probably benign	Het
Srms	G	A	2: 181,206,245	A489V	possibly damaging	Het
St3gal4	T	C	9: 35,053,262	N169S	probably damaging	Het
Taar5	T	A	10: 23,971,271	V189E	probably damaging	Het
Tbc1d32	G	A	10: 56,195,429	P333L	probably benign	Het
Tet3	G	T	6: 83,368,084	Y1790*	probably null	Het
Ticrr	T	A	7: 79,694,696	H1436Q	probably benign	Het
Ubl7	C	T	9: 57,923,272	L334F	possibly damaging	Het
Unc13a	A	G	8: 71,666,639		probably null	Het
Unc13c	T	C	9: 73,699,169	D1303G	probably damaging	Het
Vmn2r114	A	G	17: 23,290,980	L842P	possibly damaging	Het
Vps35	G	T	8: 85,261,228	Q765K	possibly damaging	Het
Zfp72	G	T	13: 74,372,524	S145*	probably null	Het
Zgrf1	C	T	3: 127,598,812	A1327V	possibly damaging	Het
Zkscan6	T	A	11: 65,828,157	S334R	probably benign	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
R7901:Lct	UTSW	1	128288985	missense	probably benign	0.44
R8033:Lct	UTSW	1	128285259	missense	probably benign	0.03
R8373:Lct	UTSW	1	128303840	missense	probably damaging	1.00
R8504:Lct	UTSW	1	128287569	missense	probably damaging	1.00
R8751:Lct	UTSW	1	128293797	missense	probably benign	0.18
R8781:Lct	UTSW	1	128287524	missense	probably damaging	1.00
R8797:Lct	UTSW	1	128303947	missense	possibly damaging	0.77
R8926:Lct	UTSW	1	128300411	missense	probably damaging	1.00
R8949:Lct	UTSW	1	128294192	missense	probably damaging	1.00
R8992:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R9138:Lct	UTSW	1	128300157	missense	probably benign	0.03
R9260:Lct	UTSW	1	128299967	nonsense	probably null
R9416:Lct	UTSW	1	128300592	missense	possibly damaging	0.74
R9531:Lct	UTSW	1	128307861	missense	probably benign	0.00
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00
Z1176:Lct	UTSW	1	128287611	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAATCCGCAGAGCCTTTCAG -3'
(R):5'- TCAGCAGGAACTTGGGAAC -3'

Sequencing Primer
(F):5'- AGCCTTTCAGGAGCCGCTTC -3'
(R):5'- GAACAGTGACTTGATAGTGTCTCTC -3'

Posted On

2018-03-15