Incidental Mutation 'R6277:Celf3'
ID 507696
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene Name CUGBP, Elav-like family member 3
Synonyms BRUNOL1, Tnrc4, CAGH4, ERDA4, 4930415M08Rik
MMRRC Submission 044447-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R6277 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 94385602-94399505 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94392672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 124 (C124R)
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000200342] [ENSMUST00000198316] [ENSMUST00000198384] [ENSMUST00000199775] [ENSMUST00000199884]
AlphaFold Q8CIN6
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: C123R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: C123R

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect probably damaging
Transcript: ENSMUST00000197558
AA Change: C47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137
AA Change: C47R

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197677
AA Change: C48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137
AA Change: C48R

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect probably damaging
Transcript: ENSMUST00000200342
AA Change: C124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: C124R

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198316
AA Change: C47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137
AA Change: C47R

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198384
AA Change: C48R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137
AA Change: C48R

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: C124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: C124R

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Meta Mutation Damage Score 0.9660 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,385,651 (GRCm39) Y105H possibly damaging Het
4921539E11Rik A T 4: 103,088,668 (GRCm39) Y179* probably null Het
Abca7 G C 10: 79,841,992 (GRCm39) V1042L probably benign Het
Adck5 C A 15: 76,477,463 (GRCm39) T99K possibly damaging Het
Adcy5 A G 16: 35,109,896 (GRCm39) T823A probably benign Het
Adra1d G T 2: 131,403,083 (GRCm39) R336S probably damaging Het
Arhgap39 A T 15: 76,619,337 (GRCm39) M749K probably damaging Het
Arid4a A G 12: 71,086,665 (GRCm39) R168G possibly damaging Het
Atxn10 A G 15: 85,275,893 (GRCm39) T317A probably benign Het
Bicc1 T C 10: 70,863,731 (GRCm39) K22E possibly damaging Het
Cacna1b T G 2: 24,620,808 (GRCm39) T281P probably damaging Het
Ccdc174 A T 6: 91,857,272 (GRCm39) Q26L probably damaging Het
Cfap44 A G 16: 44,257,669 (GRCm39) E1068G probably benign Het
Crybg1 T A 10: 43,873,255 (GRCm39) E1284D probably benign Het
Dcbld2 T A 16: 58,272,119 (GRCm39) Y392N probably damaging Het
Dcbld2 C T 16: 58,285,866 (GRCm39) P675L probably damaging Het
Dnah12 A T 14: 26,492,439 (GRCm39) H1193L probably damaging Het
Efcab3 G C 11: 104,901,148 (GRCm39) E4422D possibly damaging Het
Ern2 A G 7: 121,785,330 (GRCm39) F16L probably benign Het
Fam163b G T 2: 27,002,763 (GRCm39) T78N probably benign Het
Fbxw21 A T 9: 108,974,623 (GRCm39) I299K possibly damaging Het
Foxg1 A G 12: 49,432,299 (GRCm39) N344S probably benign Het
Git2 A G 5: 114,871,308 (GRCm39) I202T probably damaging Het
Gm11595 G T 11: 99,663,510 (GRCm39) P57T unknown Het
Gm12258 G A 11: 58,745,113 (GRCm39) V15M probably damaging Het
Gm15056 C T 8: 21,390,914 (GRCm39) G40S probably damaging Het
Gnal C A 18: 67,346,143 (GRCm39) H274Q probably damaging Het
Hormad2 A T 11: 4,371,583 (GRCm39) probably null Het
Ighv7-2 A G 12: 113,876,087 (GRCm39) I6T probably benign Het
Irf9 A G 14: 55,845,109 (GRCm39) D323G probably benign Het
Klhl23 G T 2: 69,664,096 (GRCm39) D482Y probably damaging Het
Lama4 A G 10: 38,982,006 (GRCm39) N1745S probably damaging Het
Lct T A 1: 128,231,974 (GRCm39) Y625F probably benign Het
Lrrc26 T C 2: 25,180,116 (GRCm39) V39A probably benign Het
Mllt6 G A 11: 97,564,774 (GRCm39) A527T probably damaging Het
Mrgprb4 T A 7: 47,848,649 (GRCm39) D93V probably benign Het
Nlrp5 A G 7: 23,120,880 (GRCm39) D698G probably damaging Het
Or13p10 T A 4: 118,523,520 (GRCm39) S269T probably benign Het
Pacsin1 T A 17: 27,924,969 (GRCm39) probably null Het
Padi3 A T 4: 140,518,472 (GRCm39) probably null Het
Pcdha8 T C 18: 37,127,411 (GRCm39) I631T probably damaging Het
Pkn3 G A 2: 29,972,957 (GRCm39) G315D possibly damaging Het
Ppfibp1 T A 6: 146,907,422 (GRCm39) D228E probably benign Het
Prag1 G T 8: 36,613,745 (GRCm39) R1099L probably damaging Het
Pramel31 A G 4: 144,090,223 (GRCm39) E421G probably damaging Het
Prr36 A G 8: 4,264,746 (GRCm39) probably benign Het
Prrc2c A G 1: 162,541,883 (GRCm39) S369P probably benign Het
Ptprn2 A G 12: 116,839,800 (GRCm39) D441G probably benign Het
Slc9c1 G A 16: 45,427,204 (GRCm39) probably benign Het
Slit1 G A 19: 41,588,948 (GRCm39) T1513I possibly damaging Het
Smcr8 C T 11: 60,669,635 (GRCm39) T261M probably benign Het
Spata17 G A 1: 186,926,151 (GRCm39) R60* probably null Het
Speer4f1 A G 5: 17,681,241 (GRCm39) R40G probably damaging Het
Spns3 A G 11: 72,420,466 (GRCm39) V340A possibly damaging Het
Srgap3 T C 6: 112,716,344 (GRCm39) I595V probably benign Het
Srms G A 2: 180,848,038 (GRCm39) A489V possibly damaging Het
St3gal4 T C 9: 34,964,558 (GRCm39) N169S probably damaging Het
Taar5 T A 10: 23,847,169 (GRCm39) V189E probably damaging Het
Tbc1d32 G A 10: 56,071,525 (GRCm39) P333L probably benign Het
Tet3 G T 6: 83,345,066 (GRCm39) Y1790* probably null Het
Ticrr T A 7: 79,344,444 (GRCm39) H1436Q probably benign Het
Top6bl G T 19: 4,677,250 (GRCm39) S466* probably null Het
Ubl7 C T 9: 57,830,555 (GRCm39) L334F possibly damaging Het
Unc13a A G 8: 72,119,283 (GRCm39) probably null Het
Unc13c T C 9: 73,606,451 (GRCm39) D1303G probably damaging Het
Vmn2r114 A G 17: 23,509,954 (GRCm39) L842P possibly damaging Het
Vps35 G T 8: 85,987,857 (GRCm39) Q765K possibly damaging Het
Zfp87 G T 13: 74,520,643 (GRCm39) S145* probably null Het
Zgrf1 C T 3: 127,392,461 (GRCm39) A1327V possibly damaging Het
Zkscan6 T A 11: 65,718,983 (GRCm39) S334R probably benign Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94,395,535 (GRCm39) missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94,394,108 (GRCm39) missense probably damaging 1.00
IGL03007:Celf3 APN 3 94,394,444 (GRCm39) missense probably benign 0.00
R0180:Celf3 UTSW 3 94,392,647 (GRCm39) missense probably damaging 1.00
R0670:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R1965:Celf3 UTSW 3 94,392,634 (GRCm39) missense probably damaging 1.00
R2232:Celf3 UTSW 3 94,387,566 (GRCm39) splice site probably null
R2566:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R3546:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R3547:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R3548:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R4015:Celf3 UTSW 3 94,394,505 (GRCm39) missense probably benign 0.02
R4471:Celf3 UTSW 3 94,395,585 (GRCm39) splice site probably null
R4698:Celf3 UTSW 3 94,392,174 (GRCm39) critical splice donor site probably null
R4816:Celf3 UTSW 3 94,386,529 (GRCm39) missense probably damaging 1.00
R4939:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R5851:Celf3 UTSW 3 94,386,433 (GRCm39) missense probably damaging 1.00
R6400:Celf3 UTSW 3 94,387,593 (GRCm39) missense probably damaging 1.00
R6986:Celf3 UTSW 3 94,395,024 (GRCm39) missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94,387,637 (GRCm39) missense probably damaging 0.99
R7556:Celf3 UTSW 3 94,387,590 (GRCm39) missense probably damaging 1.00
R8141:Celf3 UTSW 3 94,395,850 (GRCm39) missense probably damaging 1.00
R8290:Celf3 UTSW 3 94,386,489 (GRCm39) missense probably benign 0.44
R8978:Celf3 UTSW 3 94,392,667 (GRCm39) missense probably benign 0.22
R9255:Celf3 UTSW 3 94,392,594 (GRCm39) missense probably benign 0.25
R9636:Celf3 UTSW 3 94,394,580 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCCACAGTTTCCCAGGATG -3'
(R):5'- ATGGAAGTGTGCTCTGTGCC -3'

Sequencing Primer
(F):5'- TGTCAGGAGCAACAGGGATGC -3'
(R):5'- TCCGGCTGCTGTGAAGG -3'
Posted On 2018-03-15