Incidental Mutation 'R6277:Celf3'
ID507696
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6277 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94485365 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 124 (C124R)
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000198316] [ENSMUST00000198384] [ENSMUST00000199775] [ENSMUST00000200342] [ENSMUST00000199884]
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: C123R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: C123R

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect probably damaging
Transcript: ENSMUST00000197558
AA Change: C47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137
AA Change: C47R

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197677
AA Change: C48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137
AA Change: C48R

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect probably damaging
Transcript: ENSMUST00000198316
AA Change: C47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137
AA Change: C47R

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198384
AA Change: C48R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137
AA Change: C48R

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: C124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: C124R

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200342
AA Change: C124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: C124R

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Crybg1 T A 10: 43,997,259 E1284D probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Padi3 A T 4: 140,791,161 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prag1 G T 8: 36,146,591 R1099L probably damaging Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Smcr8 C T 11: 60,778,809 T261M probably benign Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zfp72 G T 13: 74,372,524 S145* probably null Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0180:Celf3 UTSW 3 94485340 missense probably damaging 1.00
R0670:Celf3 UTSW 3 94488230 small deletion probably benign
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3548:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R5851:Celf3 UTSW 3 94479126 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94480330 missense probably damaging 0.99
R7556:Celf3 UTSW 3 94480283 missense probably damaging 1.00
R8141:Celf3 UTSW 3 94488543 missense probably damaging 1.00
R8290:Celf3 UTSW 3 94479182 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGCCACAGTTTCCCAGGATG -3'
(R):5'- ATGGAAGTGTGCTCTGTGCC -3'

Sequencing Primer
(F):5'- TGTCAGGAGCAACAGGGATGC -3'
(R):5'- TCCGGCTGCTGTGAAGG -3'
Posted On2018-03-15