Incidental Mutation 'R6277:Padi3'
ID507700
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Namepeptidyl arginine deiminase, type III
SynonymsPAD type III, Pdi3, Pad3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6277 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140785365-140810648 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 140791161 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000172098]
Predicted Effect probably null
Transcript: ENSMUST00000026377
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172098
SMART Domains Protein: ENSMUSP00000130721
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 14 103 3.9e-29 PFAM
Pfam:PAD_M 105 263 2.9e-69 PFAM
Pfam:PAD 268 654 5.3e-226 PFAM
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,694 Y105H possibly damaging Het
4921539E11Rik A T 4: 103,231,471 Y179* probably null Het
Abca7 G C 10: 80,006,158 V1042L probably benign Het
Adck5 C A 15: 76,593,263 T99K possibly damaging Het
Adcy5 A G 16: 35,289,526 T823A probably benign Het
Adra1d G T 2: 131,561,163 R336S probably damaging Het
Arhgap39 A T 15: 76,735,137 M749K probably damaging Het
Arid4a A G 12: 71,039,891 R168G possibly damaging Het
Atxn10 A G 15: 85,391,692 T317A probably benign Het
Bicc1 T C 10: 71,027,901 K22E possibly damaging Het
Cacna1b T G 2: 24,730,796 T281P probably damaging Het
Ccdc174 A T 6: 91,880,291 Q26L probably damaging Het
Celf3 T C 3: 94,485,365 C124R probably damaging Het
Cfap44 A G 16: 44,437,306 E1068G probably benign Het
Crybg1 T A 10: 43,997,259 E1284D probably benign Het
Dcbld2 T A 16: 58,451,756 Y392N probably damaging Het
Dcbld2 C T 16: 58,465,503 P675L probably damaging Het
Dnah12 A T 14: 26,770,482 H1193L probably damaging Het
Ern2 A G 7: 122,186,107 F16L probably benign Het
Fam163b G T 2: 27,112,751 T78N probably benign Het
Fbxw21 A T 9: 109,145,555 I299K possibly damaging Het
Foxg1 A G 12: 49,385,516 N344S probably benign Het
Git2 A G 5: 114,733,247 I202T probably damaging Het
Gm11595 G T 11: 99,772,684 P57T unknown Het
Gm11639 G C 11: 105,010,322 E4422D possibly damaging Het
Gm12258 G A 11: 58,854,287 V15M probably damaging Het
Gm13119 A G 4: 144,363,653 E421G probably damaging Het
Gm15056 C T 8: 20,900,898 G40S probably damaging Het
Gm960 G T 19: 4,627,222 S466* probably null Het
Gnal C A 18: 67,213,072 H274Q probably damaging Het
Hormad2 A T 11: 4,421,583 probably null Het
Ighv7-2 A G 12: 113,912,467 I6T probably benign Het
Irf9 A G 14: 55,607,652 D323G probably benign Het
Klhl23 G T 2: 69,833,752 D482Y probably damaging Het
Lama4 A G 10: 39,106,010 N1745S probably damaging Het
Lct T A 1: 128,304,237 Y625F probably benign Het
Lrrc26 T C 2: 25,290,104 V39A probably benign Het
Mllt6 G A 11: 97,673,948 A527T probably damaging Het
Mrgprb4 T A 7: 48,198,901 D93V probably benign Het
Nlrp5 A G 7: 23,421,455 D698G probably damaging Het
Olfr62 T A 4: 118,666,323 S269T probably benign Het
Pacsin1 T A 17: 27,705,995 probably null Het
Pcdha8 T C 18: 36,994,358 I631T probably damaging Het
Pkn3 G A 2: 30,082,945 G315D possibly damaging Het
Ppfibp1 T A 6: 147,005,924 D228E probably benign Het
Prag1 G T 8: 36,146,591 R1099L probably damaging Het
Prr36 A G 8: 4,214,746 probably benign Het
Prrc2c A G 1: 162,714,314 S369P probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Slc9c1 G A 16: 45,606,841 probably benign Het
Slit1 G A 19: 41,600,509 T1513I possibly damaging Het
Smcr8 C T 11: 60,778,809 T261M probably benign Het
Spata17 G A 1: 187,193,954 R60* probably null Het
Speer4f1 A G 5: 17,476,243 R40G probably damaging Het
Spns3 A G 11: 72,529,640 V340A possibly damaging Het
Srgap3 T C 6: 112,739,383 I595V probably benign Het
Srms G A 2: 181,206,245 A489V possibly damaging Het
St3gal4 T C 9: 35,053,262 N169S probably damaging Het
Taar5 T A 10: 23,971,271 V189E probably damaging Het
Tbc1d32 G A 10: 56,195,429 P333L probably benign Het
Tet3 G T 6: 83,368,084 Y1790* probably null Het
Ticrr T A 7: 79,694,696 H1436Q probably benign Het
Ubl7 C T 9: 57,923,272 L334F possibly damaging Het
Unc13a A G 8: 71,666,639 probably null Het
Unc13c T C 9: 73,699,169 D1303G probably damaging Het
Vmn2r114 A G 17: 23,290,980 L842P possibly damaging Het
Vps35 G T 8: 85,261,228 Q765K possibly damaging Het
Zfp72 G T 13: 74,372,524 S145* probably null Het
Zgrf1 C T 3: 127,598,812 A1327V possibly damaging Het
Zkscan6 T A 11: 65,828,157 S334R probably benign Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140803624 missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140796334 splice site probably benign
IGL02400:Padi3 APN 4 140788868 missense probably benign 0.00
IGL02449:Padi3 APN 4 140789712 critical splice donor site probably null
IGL02600:Padi3 APN 4 140798156 missense probably benign 0.15
IGL03342:Padi3 APN 4 140810598 nonsense probably null
FR4304:Padi3 UTSW 4 140792972 critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140791483 missense probably benign 0.00
R0455:Padi3 UTSW 4 140795713 missense probably damaging 1.00
R0743:Padi3 UTSW 4 140786429 missense probably benign 0.00
R1279:Padi3 UTSW 4 140803577 missense probably benign 0.00
R2081:Padi3 UTSW 4 140798979 missense probably damaging 1.00
R3016:Padi3 UTSW 4 140786587 missense probably damaging 1.00
R3853:Padi3 UTSW 4 140791269 splice site probably benign
R4599:Padi3 UTSW 4 140798111 missense probably damaging 1.00
R4909:Padi3 UTSW 4 140795626 missense probably damaging 1.00
R5370:Padi3 UTSW 4 140810538 nonsense probably null
R5482:Padi3 UTSW 4 140795843 missense probably damaging 0.99
R6084:Padi3 UTSW 4 140795843 missense probably damaging 1.00
R6151:Padi3 UTSW 4 140796394 missense probably damaging 1.00
R6343:Padi3 UTSW 4 140803508 missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140795853 missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140800124 missense probably damaging 1.00
R7403:Padi3 UTSW 4 140800119 missense probably benign
R7798:Padi3 UTSW 4 140786439 missense probably benign
R7818:Padi3 UTSW 4 140798142 missense possibly damaging 0.72
RF025:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF032:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF040:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF043:Padi3 UTSW 4 140792972 critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140795671 missense possibly damaging 0.92
Z1176:Padi3 UTSW 4 140798123 missense not run
Z1177:Padi3 UTSW 4 140798123 missense not run
Predicted Primers PCR Primer
(F):5'- AACACTAAACCTGTGCCCGG -3'
(R):5'- TAGACAAGCCTTGGCCTCTAGG -3'

Sequencing Primer
(F):5'- TTCTGAGCAGAGCCCGGATG -3'
(R):5'- AGCCTTGGCCTCTAGGGTTAG -3'
Posted On2018-03-15