Mutagenetix > Incidental Mutation

Incidental Mutation 'R6277:Ticrr'

507710

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

044447-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R6277 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79694696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1436 (H1436Q)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

probably benign
Transcript: ENSMUST00000035977
AA Change: H1436Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: H1436Q

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059836

SMART Domains

Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178048

SMART Domains

Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183846

SMART Domains

Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184137

SMART Domains

Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206591

Predicted Effect

probably benign
Transcript: ENSMUST00000206622

Meta Mutation Damage Score

0.1368

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.2%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,663,694	Y105H	possibly damaging	Het
4921539E11Rik	A	T	4: 103,231,471	Y179*	probably null	Het
Abca7	G	C	10: 80,006,158	V1042L	probably benign	Het
Adck5	C	A	15: 76,593,263	T99K	possibly damaging	Het
Adcy5	A	G	16: 35,289,526	T823A	probably benign	Het
Adra1d	G	T	2: 131,561,163	R336S	probably damaging	Het
Arhgap39	A	T	15: 76,735,137	M749K	probably damaging	Het
Arid4a	A	G	12: 71,039,891	R168G	possibly damaging	Het
Atxn10	A	G	15: 85,391,692	T317A	probably benign	Het
Bicc1	T	C	10: 71,027,901	K22E	possibly damaging	Het
Cacna1b	T	G	2: 24,730,796	T281P	probably damaging	Het
Ccdc174	A	T	6: 91,880,291	Q26L	probably damaging	Het
Celf3	T	C	3: 94,485,365	C124R	probably damaging	Het
Cfap44	A	G	16: 44,437,306	E1068G	probably benign	Het
Crybg1	T	A	10: 43,997,259	E1284D	probably benign	Het
Dcbld2	T	A	16: 58,451,756	Y392N	probably damaging	Het
Dcbld2	C	T	16: 58,465,503	P675L	probably damaging	Het
Dnah12	A	T	14: 26,770,482	H1193L	probably damaging	Het
Ern2	A	G	7: 122,186,107	F16L	probably benign	Het
Fam163b	G	T	2: 27,112,751	T78N	probably benign	Het
Fbxw21	A	T	9: 109,145,555	I299K	possibly damaging	Het
Foxg1	A	G	12: 49,385,516	N344S	probably benign	Het
Git2	A	G	5: 114,733,247	I202T	probably damaging	Het
Gm11595	G	T	11: 99,772,684	P57T	unknown	Het
Gm11639	G	C	11: 105,010,322	E4422D	possibly damaging	Het
Gm12258	G	A	11: 58,854,287	V15M	probably damaging	Het
Gm13119	A	G	4: 144,363,653	E421G	probably damaging	Het
Gm15056	C	T	8: 20,900,898	G40S	probably damaging	Het
Gm960	G	T	19: 4,627,222	S466*	probably null	Het
Gnal	C	A	18: 67,213,072	H274Q	probably damaging	Het
Hormad2	A	T	11: 4,421,583		probably null	Het
Ighv7-2	A	G	12: 113,912,467	I6T	probably benign	Het
Irf9	A	G	14: 55,607,652	D323G	probably benign	Het
Klhl23	G	T	2: 69,833,752	D482Y	probably damaging	Het
Lama4	A	G	10: 39,106,010	N1745S	probably damaging	Het
Lct	T	A	1: 128,304,237	Y625F	probably benign	Het
Lrrc26	T	C	2: 25,290,104	V39A	probably benign	Het
Mllt6	G	A	11: 97,673,948	A527T	probably damaging	Het
Mrgprb4	T	A	7: 48,198,901	D93V	probably benign	Het
Nlrp5	A	G	7: 23,421,455	D698G	probably damaging	Het
Olfr62	T	A	4: 118,666,323	S269T	probably benign	Het
Pacsin1	T	A	17: 27,705,995		probably null	Het
Padi3	A	T	4: 140,791,161		probably null	Het
Pcdha8	T	C	18: 36,994,358	I631T	probably damaging	Het
Pkn3	G	A	2: 30,082,945	G315D	possibly damaging	Het
Ppfibp1	T	A	6: 147,005,924	D228E	probably benign	Het
Prag1	G	T	8: 36,146,591	R1099L	probably damaging	Het
Prr36	A	G	8: 4,214,746		probably benign	Het
Prrc2c	A	G	1: 162,714,314	S369P	probably benign	Het
Ptprn2	A	G	12: 116,876,180	D441G	probably benign	Het
Slc9c1	G	A	16: 45,606,841		probably benign	Het
Slit1	G	A	19: 41,600,509	T1513I	possibly damaging	Het
Smcr8	C	T	11: 60,778,809	T261M	probably benign	Het
Spata17	G	A	1: 187,193,954	R60*	probably null	Het
Speer4f1	A	G	5: 17,476,243	R40G	probably damaging	Het
Spns3	A	G	11: 72,529,640	V340A	possibly damaging	Het
Srgap3	T	C	6: 112,739,383	I595V	probably benign	Het
Srms	G	A	2: 181,206,245	A489V	possibly damaging	Het
St3gal4	T	C	9: 35,053,262	N169S	probably damaging	Het
Taar5	T	A	10: 23,971,271	V189E	probably damaging	Het
Tbc1d32	G	A	10: 56,195,429	P333L	probably benign	Het
Tet3	G	T	6: 83,368,084	Y1790*	probably null	Het
Ubl7	C	T	9: 57,923,272	L334F	possibly damaging	Het
Unc13a	A	G	8: 71,666,639		probably null	Het
Unc13c	T	C	9: 73,699,169	D1303G	probably damaging	Het
Vmn2r114	A	G	17: 23,290,980	L842P	possibly damaging	Het
Vps35	G	T	8: 85,261,228	Q765K	possibly damaging	Het
Zfp72	G	T	13: 74,372,524	S145*	probably null	Het
Zgrf1	C	T	3: 127,598,812	A1327V	possibly damaging	Het
Zkscan6	T	A	11: 65,828,157	S334R	probably benign	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GAGAATGACCTGCCCCATAC -3'
(R):5'- AATCCCAGGGTCAGACACAG -3'

Sequencing Primer
(F):5'- TCCAAGCTTCGGAGATCATG -3'
(R):5'- CACAGAGGGAAGCTCGTC -3'

Posted On

2018-03-15